We narrowed to 19,813 results for: INO
-
Plasmid#194046PurposeTransient expression of AtOEP7-VC155 (mVenus β-strands 8 to 11, amino acids 155−239) in plant cell (Chloroplast outer envelope membrane)DepositorInsertVC155 (mVenus β-strands 8 to 11, amino acids 155−239)
TagsAtOEP7 1–50aaExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-AtOEP7(1-50aa)-VN154
Plasmid#194045PurposeTransient expression of AtOEP7-VN154 (mVenus β-strands 1 to 7, amino acids 1−154) in plant cell (Chloroplast outer envelope membrane)DepositorInsertVN154 (mVenus β-strands 1 to 7, amino acids 1−154)
TagsAtOEP7 1–50aaExpressionPlantPromoterCaMV 35S promoterAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-INS-sg
Plasmid#194719PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hINSDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-MAFB-sg
Plasmid#194718PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hMAFBDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Tesmin-BioID2-3xFLAG
Plasmid#186815PurposeCAG promoter-driven expression of TESMIN-BioID2-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn-Tesmin-BioID2-3xFLAG
Plasmid#186816PurposeMouse Clgn promoter-driven expression of TESMIN-BioID2-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn-Tesmin-TurboID-3xFLAG
Plasmid#186817PurposeMouse Clgn promoter-driven expression of TESMIN-TurboID-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSKΔB-24xopto-TetO-no01
Plasmid#174887PurposePlasmid vector containing southern blot probe for opto-TetO in STREAMING-tagDepositorInsert24xopto-TetO
UseSouthern blot probeAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT002
Plasmid#182712PurposeaTc inducible dCasRx-IF1DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 1ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB430
Plasmid#185091PurposeNMA111-GFP with first nuclear localization signal mutated (amino acids 28 - 30, KRK -> AAA)DepositorInsertNMA111
TagsGFPExpressionYeastMutationFirst nuclear localization signal mutated (amino …Available SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB428
Plasmid#185090PurposeNMA111-GFP with first nuclear localization signal mutated (amino acids 9 - 11, KKR -> AAA)DepositorInsertNMA111
TagsGFPExpressionYeastMutationFirst nuclear localization signal mutated (amino …Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1pCNPRS
Plasmid#174719PurposetRNA synthetase/tRNA pair for the in vivo incorporation of L-3-(2-cyano-5-pyridyl)alanine (pCNP), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2Aneo-mRFP-FKBP-mSos1-linkercat
Plasmid#173858PurposeEncoding a part of the rapamycin-induced Ras activation system.DepositorInsertmRFP-FKBP-mSos1-linkercat
ExpressionMammalianAvailable SinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1010Av2
Plasmid#176082PurposepBac-10xUAS-L596_g9608-p10-UTR-Opie2-dsRedDepositorInsertL596_g9608.t1
Tags3xHAExpressionBacterialAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
OA-1010Bv2
Plasmid#176083PurposepBac-10xUAS-L596_g25050-p10-UTR-Opie2-dsRedDepositorInsertL596_g25050.t1
Tags3xHAExpressionBacterialAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T Syt1 C2AB(140) M173C
Plasmid#134696PurposeEncodes cytoplasmic domain of synaptotagmin-1 for bacterial expression, purification, and labelingDepositorAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T Syt1 C2AB(140) F234C
Plasmid#134697PurposeEncodes cytoplasmic domain of synaptotagmin-1 for bacterial expression, purification, and labelingDepositorAvailable SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only