We narrowed to 64,632 results for: cell;
-
Plasmid#128748PurposeExpresses mCherry in mammalian cells. ~200 nt of Cyrano with miR-7 site replaced by miR-17 site inserted in mCherry 3'UTR.DepositorInsertCyrano conserved region (CR1) with miR-17 site replacing miR-7 site (OIP5-AS1 Human)
ExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKP136 (pRS406-PRC1p-PRC1-PA-ADH1t)
Plasmid#106471PurposeExpresses Prc1 with a C-terminal PA tag in yeast cellsDepositorInsertPRC1
TagsPAExpressionBacterial and YeastPromoterPRC1Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDOE11 mas:mTq2 transient
Plasmid#124248PurposeAllows bimolecular fluorescence complementation via transient expression of two proteins in directly transfected plant cells.DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCDH-bio-His
Plasmid#53336PurposeExpresses full-length Protocadherin alpha-2 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPCDH (PCDHA2 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg resistant gamma-tubulin
Plasmid#104433PurposeFor expressing gamma-tubulin in cells expressing γTUBULIN single guide RNADepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsNoneExpressionMammalianMutationchanged t bp28 to c; g bp30 to a; c bp33 to a; …Available SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLaNGo11-3
Plasmid#126054PurposeA self-assembling split-GFP based Golden Gate vector to determine protein targeting to plastids in plant cellDepositorInsertschloroplastic FNR transit peptide
ccdB cassette (BsaI)
GFP11x3 (5 aa linker)
UseBinaryTagsGFP1-10ExpressionPlantAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMiNGo11-1
Plasmid#126056PurposeA self-assembling split-GFP based Golden Gate vector to determine protein targeting to mitochondria in plant cellDepositorInsertsmitochondria Rieske iron sulphur protein (1-100 aa)
ccdB cassette (BsaI)
GFP11
UseBinaryTagsGFP1-10ExpressionPlantAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
OTOA-bio-His
Plasmid#53356PurposeExpresses full-length Otoancorin precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertOTOA (OTOA Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
mOC-STAMP_pcDNA3.1 D/V5-His-TOPO
Plasmid#73448PurposeExpress mouse OC-STAMP in mammalian cellsDepositorAvailable SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOPTXGARE
Plasmid#68542Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with GARE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation5x GARE inserted 190 bp 5' pf ATG (GARE = ta…PromoterOPTX promoter with GAREAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC35
Plasmid#62325PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC102
Plasmid#62337PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCINTBeta1
Plasmid#14067DepositorInsertChicken Beta 1 Integrin (ITGB1 Chicken)
ExpressionMammalianMutationPstI-BglI fragment was blunt end cloned and EcoRI…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
CLM RP KGF Mut 1
Plasmid#24166DepositorInsertKinesin (KIF5B Human)
Tags6XHis and GFPExpressionBacterialMutationC7S/C65A/C168A/C174S/C294A/C330S/C421AAvailable SinceMay 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEF Itk Y511F myc
Plasmid#20709DepositorAvailable SinceApril 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-RH-β+ε
Plasmid#247178PurposeFor generating Sleeping Beauty-based stable cell line expressing human muscle acetylcholine receptor beta1 and epsilon subunits. Expresses RFP; hygromycin selection.DepositorInsertHuman muscle acetylcholine receptor beta and epsilon subunits
Tags3xFLAG tagExpressionMammalianAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-GP-α+δ
Plasmid#247177PurposeFor generating Sleeping Beauty-based stable cell line expressing human muscle acetylcholine receptor alpha1 and delta subunits. Expresses GFP; puromycin selection.DepositorInsertHuman muscle acetylcholine receptor alpha1 and delta subunits
TagsTwin strep tagExpressionMammalianAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
2xmyc-RILPL1
Plasmid#244982PurposeExpress RILPL1 in mammalian cells with 2xmyc tagDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
mBaoJin-RILPL1
Plasmid#244985PurposeExpress RILPL1 in mammalian cells with mBaoJin tag (monomeric StayGold)DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBtA3-3AF
Plasmid#245785PurposeExpression of mutated bovine arrestin-3 (I385A, V386A, F387A) tagged with SmBiT and Flag in mammalian cellsDepositorInsertarrestin-3 (ARR3 Bovine)
TagsFlag and SmBiTExpressionMammalianMutationI385A, V386A, F387APromoterCMVAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-NLS-mScarleti-NLS-IRES-Puromycin
Plasmid#234890PurposeExpressed a nuclear mScarleti fluorophoro in mammalian cellsDepositorInsertmScarleti
TagsNLS on N- and C- terminalsExpressionMammalianPromoterCAGAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-RILPL1
Plasmid#244980PurposeExpress RILPL1 in mammalian cells with mCherry tagDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-CIBN-p53CT(98-393)-mNeonGreen
Plasmid#241844PurposeExpresses a localizer of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCIBN and mNeonGreenExpressionMammalianMutationC-terminus (97-393 aa)PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DEST40-SIRT1
Plasmid#242124PurposeExpression in mammalian cellsDepositorAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIN-FHA2 R605A-Ypet-34-ECFP-hLaminA
Plasmid#235123PurposeFHA2-mutated FRET biosensor R605A; FRET biosensor for live cell visualization of pSer22 Lamin ADepositorInsertFHA2 R605A-Ypet-34-ECFP-hLaminA
UseLentiviralExpressionMammalianMutationFHA2 R605AAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
WT-Cas9
Plasmid#239382PurposeFor circular RNA-mediated inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9
UseCRISPRTagsBPNLS and SV40 NLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
iPE-WT-Cas9
Plasmid#239379PurposeFor inverse prime editor using WTCas9 in HEK294T cellsDepositorInsertCas9, M-MLV RT
UseCRISPRTagsBPNLSExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-23012
Plasmid#109180PurposePlasmid for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-23122
Plasmid#109181PurposePlasmid for expression of N-terminally 3xFLAG-tagged proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23003
Plasmid#109183PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23004
Plasmid#109184PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23005
Plasmid#109185PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21122
Plasmid#109174PurposePlasmid for expression of N-terminally 3xFLAG-tagged proteins under the control of a polh promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterpolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222
Plasmid#109175PurposePlasmid for expression of C-terminally 3xFLAG-tagged proteins under the control of a polh promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterpolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21232
Plasmid#109177PurposePlasmid for expression of C-terminally CBP-3xFLAG-ProteinA-tagged proteins under the control of a polh promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTagsCBP-3xFLAG-ProteinAExpressionInsectPromoterpolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-MCP-3XBFP-NLS
Plasmid#236372PurposeOverexpression of MCP-3XBFPnls in human cellsDepositorInsertMCP-3XBFPnls
UseLentiviralAvailable SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10 ΔF
Plasmid#145816PurposeExpresses EGFP-tagged MYO10 with MyTH/FERM deletion in mammalian cellsDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-mCherry
Plasmid#216174PurposeGenerate lentiviruses to act as a positive transduction control for pHAGE2-TetO vectors in pluripotency reprogrammingDepositorInsertmCherry
UseLentiviralAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only