We narrowed to 24,354 results for: CRISPR
-
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PKN1 gRNA (BRDN0001162558)
Plasmid#76278Purpose3rd generation lentiviral gRNA plasmid targeting human PKN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147151)
Plasmid#76461Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147212)
Plasmid#76463Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g2)-PGKpuroBFP-W
Plasmid#105036PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
PFKFB4 gRNA (BRDN0001149495)
Plasmid#77123Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB4DepositorAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKG1 gRNA (BRDN0001144981)
Plasmid#76356Purpose3rd generation lentiviral gRNA plasmid targeting human PHKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA pDEST40 Cas9-HMGB1
Plasmid#183195PurposeExpression cloneDepositorInsertHMGB1
UseCRISPRTagsCas9WTExpressionMammalianMutationn/aAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001146969)
Plasmid#77982Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHS1232
Plasmid#205969PurposeMWEE01000013 Cas5-HNH operon (E. coli codon optimized) + CRISPR array in pACYCDuet-1 Lac promotersDepositorInsertCas5-HNH proteins and CRISPR array
ExpressionBacterialPromoterLac (proteins), pJ23119 (crRNA)Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
STK17A gRNA (BRDN0001149480)
Plasmid#77916Purpose3rd generation lentiviral gRNA plasmid targeting human STK17ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17B gRNA (BRDN0001146764)
Plasmid#76798Purpose3rd generation lentiviral gRNA plasmid targeting human STK17BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146792)
Plasmid#77948Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146747)
Plasmid#77949Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001487150)
Plasmid#77950Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQCas12j2
Plasmid#189780PurposeGateway entry plasmid (attL1 & attR5) expressing NLS-Cas12j2-NLS, without promoterDepositorInsertCas12j2
UseCRISPR; Gateway compatible cas12j2 entry cloneTagsNLSExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only