We narrowed to 718 results for: PRS3
-
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUNIV-EGFP
Plasmid#24706DepositorInsertEGFP (eGFP Aequoria victoria)
ExpressionBacterial, Mammalian, and Y…Available SinceDec. 6, 2010AvailabilityAcademic Institutions and Nonprofits only -
KBB460
Plasmid#185094PurposeNMA111-GFP wild type under endogenous promoterDepositorInsertNMA111
TagsGFPExpressionYeastMutationNMA111-GFPAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pABY-c46
Plasmid#201774PurposeExpresses mNeonGreen-tagged NbALFA under TEF1 promoter in yeastDepositorInsertNbALFA
Tags40aa Linker, mNeonGreenExpressionYeastPromoterTEF1Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACBB-eGFP
Plasmid#32551DepositorAvailable SinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pABY-c25
Plasmid#201769PurposeExpresses mNeonGreen-tagged NbALFA under CYC1 promoter in yeastDepositorInsertNbALFA
Tags40aa Linker, mNeonGreenExpressionYeastPromoterCYC1Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS314-H
Plasmid#17541DepositorAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
pCUP1pNuiHA kanMX CEN
Plasmid#131168Purposefor ScCUP1 promoter regulated N-terminal fused Nui-HA prey expression, centromeric ARS plasmid, kanMX marker confers resistance to geneticin in S. cerevisiaeDepositorTypeEmpty backboneTagsNui-HAExpressionYeastAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
p817-mgammaFcry-EGFP
Plasmid#23156DepositorInsertmouse gammaF crystallin promoter:EGFP (eGFP Mouse, mouse gammaF promoter:EGFP)
UseMulticloning site flanked by i-scei sitesMutationmouse gammaF crystallin promoter (-225 - +73) pre…Available SinceApril 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
Spt2-GFP
Plasmid#115572PurposeExpresses yeast Spt2-GFP fusion proteinDepositorInsertSPT2
TagsGFPExpressionBacterial and YeastAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LDB107
Plasmid#185423PurposeNUP1-HA CEN TRP1 AmpR. Yeast shuttle plasmid for expression of hemagluttinin tagged NUP1 nucleoporinDepositorInsertNUP1
TagsHAExpressionYeastAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB285
Plasmid#185076PurposeRFA3-GFP fusionDepositorInsertRFA3
TagsGFPExpressionYeastAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB284
Plasmid#185075PurposeRFA2-GFP fusionDepositorInsertRFA2
TagsGFPExpressionYeastAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYC44
Plasmid#63903PurposeInitial Integrative VectorDepositorTypeEmpty backboneTagsFRT::3'UTRcta::NAT::FRTExpressionYeastAvailable SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pR184
Plasmid#47952PurposertTA positive feedback loop with three tet operators in the GAL1 promoterDepositorInsertrtTA
UseTet inducible expressionExpressionYeastPromoterGal1Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
GFP-CDC12(WT)
Plasmid#1168DepositorInsertCDC12 (CDC12 Budding Yeast)
TagsGFPExpressionYeastMutationAdded N-terminal GFP to CDC12 in plasmid CDC12(WT…Available SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only