We narrowed to 26,449 results for: gfp
-
Plasmid#118313PurposeExpression of human Epac1DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pbZIP9:GFP-GUS
Plasmid#172483PurposeGFP-GUS driven by the bZIP9 promoterDepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot8
Plasmid#37367DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-Cas9GFP-W
Plasmid#200100PurposeLentiviral vector expressing Cas9 fused with GFP at the C-terminusDepositorInsertGFP
UseCRISPR and LentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SUN1 GFP
Plasmid#187682PurposeIn vivo visualization of SUN1DepositorAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-mIFT88-EGFP
Plasmid#149697PurposeExpresses mouse IFT88-EGFP in mammalian cellsDepositorAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cplx1-GFP KI
Plasmid#131475PurposeEndogenous tagging of Complexin1: C-terminal (amino acid position: L128)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXs-C3orf17-gfp
Plasmid#70265PurposeExpresses C3orf17 in mammalian cells with GFP reporter.DepositorAvailable SinceNov. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AcGFP-progerin
Plasmid#86947PurposeConstruct used to synthesize progerin mRNA. Please note the plasmid contains LMNA gene with nucleotide C1824T mutation.DepositorInsertAcGFP-progerin (LMNA Human)
UseAAVTagsAcGFPExpressionMammalianMutationprogerin sequence is LMNA gene with nucleotide C1…PromoterCMV and T7Available SinceJune 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) EGFP-RalA(WT)
Plasmid#224274PurposeCell transfection and expression of RalADepositorInsertRalA (RALA Human)
ExpressionMammalianAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMPMA3dPlac-PpipB-GFPLVA
Plasmid#23344DepositorInsertGFP(LVA)
TagsGFP(LVA)ExpressionBacterialAvailable SinceApril 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-EGFP
Plasmid#182641PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to EGFP. LaM4-EGFP also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a T7, HA, BAP and His6 epitope
TagsBAP, EGFP, HA, His6, and T7ExpressionBacterialPromoterT7Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300 (D1399Y)
Plasmid#191763PurposeExpression of EGFP fused to catalytically dead core p300 histone acetyltransferase (D1399Y)DepositorInsertFRB-EGFP-p300 core (D1399Y) (EP300 Human)
TagsEGFP (N-terminal of p300 core (D1399Y)) and FRB (…ExpressionBacterial and MammalianMutationcatalytic D1399Y mutation in p300PromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCB036 FoMV-sgGFP
Plasmid#234813PurposeTo express gRNA from Foxtail Mosaic Virus Vector targeting GFP (T-DNA)DepositorInsertgRNA targeting GFP
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-talin1 head
Plasmid#32856DepositorAvailable SinceMarch 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
6x Halo-EGFP- 2x PACT
Plasmid#107265Purpose6x Halo-EGFP- 2x PACT construct downstream of T7 promotor for in vitro transcriptionDepositorInsert6x Halo-EGFP- 2x PACT
TagsGFPExpressionMammalianPromoterT7Available SinceJuly 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-EGFP-tDeg
Plasmid#185400PurposeEGFP-tDeg fluorogenic proteinDepositorInsertEGFP-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH1-hPRMT7-GFP
Plasmid#87103Purposeexpress hPRMT7 in mammalian cellsDepositorAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
G3BP1-Grx1-roGFP2
Plasmid#236548PurposeExpressing fluorescent Grx1-roGFP2 fusion protein in mammalian cells with localization in stress granules.DepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-MYO10-BioID
Plasmid#194858PurposeExpress MYO10 tagged with eGFP (Nter) and BioID (Cter) in mammalian cells.DepositorInsertMYO10 (MYO10 Human)
TagsBioID and EGFPExpressionMammalianMutationMyoX contains a Q680R variant compared to the NCB…PromoterCMVAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only