We narrowed to 19,449 results for: cat
-
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS SARS-CoV-2 Alpha Spike
Plasmid#185691PurposeExpresses codon-optimized full length SARS-CoV-2 Alpha SpikeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSARS-CoV-2 Alpha Spike (S )
ExpressionMammalianMutationContains the following mutations: Δ69-70, Δ145, N…Promoterchicken β-actin promoter, CMV enhancerAvailable sinceJune 8, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
p-spTorA-GFP-H6C
Plasmid#168517PurposeGFP with the signal peptide of TorA (spTorA) in pBAD24. Includes a C-terminal HHHHHHC (6xHisC) extension.DepositorInsertspTorA-GFP-H6C
Tags6xHisC tag and spTorA (signal peptide of E. coli …ExpressionBacterialMutationThe mut3 GFP variant with 5 additional mutations …PromoteraraBADAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDiCre-mCherry
Plasmid#164572PurposeIntegration of a DiCre cassette in PbGFP parasite genomeDepositorInsertsFKBP12-CRE59
FRB-CRE60
mCherry
Bifunctional dihydrofolate reductase-thymidylate synthase (TGME49_249180 Toxoplasma gondii)
UseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046789
Plasmid#145660PurposeBacterial Expression plasmid for SARS-CoV-2 M (membrane)DepositorInsertSARS-CoV-2 M (membrane) (M Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;StrepIIExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available sinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046795
Plasmid#145598PurposeBacterial Expression plasmid for SARS-CoV-2 2'-O-ribose methyltransferaseDepositorInsertSARS-CoV-2 2'-O-ribose methyltransferase (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHISExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available sinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046921
Plasmid#145755PurposeBacterial Expression plasmid for SARS-CoV-2 3'-to-5' exonucleaseDepositorInsertSARS-CoV-2 3'-to-5' exonuclease (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHISExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available sinceApril 28, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB09-TRE-beta-globin-miR-124-EF1a-GFP
Plasmid#117318PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseTransposon-mediated integrationTagsGFPExpressionMammalianPromoterTet-inducible promoterAvailable sinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I no force control (F40-based)
Plasmid#119187PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between mTFP1 and mEYFP that are tension-independent.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP] (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationtruncation after aa1945PromoterTCEAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-P14P5K
Plasmid#79570Purposeexpression of mCherry-tagged CRY2PHR fused to iSH2 domain of mouse Pip5k1cDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPip5k1c (Pip5k1c Mouse)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationR445E and R446E; truncation of amino acids 636-66…PromoterCMVAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PRKACG
Plasmid#20597DepositorPublicationAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MAC-CTSL
Plasmid#172414PurposeMAC-tagged gene expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertProcathepsin L (Cathepsin L1) (CTSL Human)
TagsMAC-tagExpressionMammalianPromoterCMV promoterAvailable sinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhGC wt T2A tDimer
Plasmid#101720Purposehumanized, Neuron-specific promoter driven expression of the rhodopsin guanylyl cyclase from Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellular cAMP close to the mDepositorInsertsCatRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhSyn1 and ribosomal skip sequence T2AAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMiniCAFE
UseCRISPRMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-HOIL-1 full-length (1–510)
Plasmid#193858PurposeExpression of human His-tagged HOIL-1 (RBCK1) full-length (1–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationCodon optimised for expression in E. coliPromoterT7Available sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
S10A mutant of H3S10ph biosensor
Plasmid#120810PurposeFRET biosensor. Eliminating the H3 Serine 10 phosphorylation site in H3S10ph biosensor to abolish the detection capabilityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
ExpressionMammalianMutationSerine 10 is mutated to Alanine, and Threonine 3,…PromoterCMVAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-hDAGLa-V5
Plasmid#87674PurposeExpresses human DAGLa protein with a HA tag inserted in the first extracellular loop, and intracellular V5 tag located on the C-terminalDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHuman Diacylglycerol Lipase Alpha (DAGLA Human)
TagsHA and V5 tagExpressionMammalianMutationHemagglutinin (HA) peptide sequence (YPYDVPDYA) f…PromoterT7Available sinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by