We narrowed to 13,575 results for: GAN
-
Plasmid#157788PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 25 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_25bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nuclear cpGFP
Plasmid#215707PurposeExpresses cpGFP in the nucleusDepositorInsertcpGFP
UseLentiviralTagsFLAG, HA, and NLSExpressionMammalianMutationcircularly permuted GFPPromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
cytoplasmic NAD+ biosensor
Plasmid#186787PurposeNAD+ biosensor comprised of a circularly permuted Venus fluorescent protein (cpVenus), a bipartite NAD+-binding domain modeled from bacterial DNA ligase, and a localization tag to target the cytoplasmDepositorInsertcytoplasmic NAD+ biosensor
UseLentiviralExpressionMammalianAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mCherry-flex-dtA
Plasmid#58536PurposeExpresses diphtheria toxin A subunit in Cre positive cells, and mCherry in all the infected cellsDepositorAvailable SinceAug. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP- SEC61B
Plasmid#121159PurposeMammalian expression of GFP tagged SEC61B, used as a general ER markerDepositorInsertSEC61B (SEC61B Human)
ExpressionMammalianAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_30bpLinker
Plasmid#157789PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 30 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_30bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
ML1Nwt_in_pEGFP-C1
Plasmid#67797PurposeMammalian expression vector driving Mouse ML1Nwt (2xML1N domain wildtype version) fused to EGFPDepositorInsertML1N*2-EGFP
ExpressionMammalianPromoterCMVAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWM_12x601_35bpLinker
Plasmid#157790PurposeEcoRV digestion produces 12x601 chromatin assembly construct with 35 bp linker lengths in addition to carrier DNA that prevents overassembly of nucleosomesDepositorInsert12x601_35bp linker
ExpressionBacterialAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a_T5-ARG1
Plasmid#106476PurposeExpresses acoustic reporter genes or gas vesicles (ARG1) in Escherichia coli Nissle 1917DepositorInsertARG1
UseSynthetic BiologyExpressionBacterialPromoterT5Available SinceMarch 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0101
Plasmid#90998PurposeModule A, Promoter: 35S, Gene: AtCas9, Terminator: HSPDepositorInsertAtCas9
UseCRISPRPromoter35SAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRANS_221
Plasmid#91115PurposeTransformation, Type: T-DNA, Plant Selection: 2x35S:npt II, Viral Replication: BeYDVDepositorTypeEmpty backboneExpressionPlantPromoter35SAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV GFP1-9
Plasmid#182244PurposeTripartite split-GFP mammalian. Express GFP1-9 detector fragmentDepositorInsertGFP 1-9 OPT
ExpressionMammalianPromoterCMVAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Eef1a-1955/-1>nls::Cas9::nls
Plasmid#59987PurposeEef1a (EF1alpha) promoter driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Eef1a (EF1alpha) -1955/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
3xHA-miniTurbo-NLS_pCDNA3
Plasmid#107172Purposeexpresses 3xHA-tagged miniTurbo in the mammalian nucleusDepositorInsertminiTurbo (BirA mutant)
ExpressionMammalianMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
nls-EGFP
Plasmid#67652PurposeMammalian expression vector driving nls-EGFP.DepositorInsertnls-EGFP
ExpressionMammalianPromoterCMVAvailable SinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
nuclear NAD+ biosensor
Plasmid#186789PurposeNAD+ biosensor comprised of a circularly permuted Venus fluorescent protein (cpVenus), a bipartite NAD+-binding domain modeled from bacterial DNA ligase, and a localization tag to target the nucleusDepositorInsertnuclear NAD+ biosensor
UseLentiviralExpressionMammalianAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAd388-shLuc
Plasmid#83275PurposeshRNA targeting luciferaceDepositorInsertshRNA to Luciferase
UseRetroviralPromoterpUC oriAvailable SinceDec. 2, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only