We narrowed to 12,197 results for: SHA;
-
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
-
EGFP-DCX
Plasmid#32852DepositorAvailable SinceOct. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CamKIIa_GFP
Plasmid#96941PurposeTo label mature excitatory iPSC-derived human neuronsDepositorInsertGreen fluorescent protein
UseLentiviralPromoterCaMKIIaAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-Rpl22-HA
Plasmid#111811PurposeExpress Rpl22HA in astrocytesDepositorInsertRibosomal protein L22 (Rpl22 Mouse)
TagsHAAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro
Plasmid#227269PurposeEmpty AAVS1 targeting donor for the insertion of Puro and a medium strength PGK promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
I48 ELP
Plasmid#68937PurposeElastin-like polypeptide (VPGxG) with 48 repeats of Isoleucine guest residueDepositorInsertI48 ELP
ExpressionBacterialPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB_TetON_mCherry_P2AT2A_GFP-nb-2xKS_FtoG
Plasmid#238244PurposeFor integration of mCherry_P2AT2A_GFP-nb-2xKS_FtoGDepositorInsertmCherry_P2AT2A_GFP-nb-2xKS_FtoG
ExpressionMammalianAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyso-ExRai-AMPKAR
Plasmid#192449PurposeExRai-AMPKAR targeted to the lysosomal membrane.DepositorInsertLyso-ExRai-AMPKAR
TagsFull-length LAMP1ExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p1A
Plasmid#162692PurposeExpresses H. neapolitanus CbbLS and S. elongatus Prk. Rescues CCMB1 in M9 glycerol at 10% CO2DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry_P2AT2A_GFP-nb-KS-FtoG
Plasmid#238235PurposeFor overexpression of mCherry_P2AT2A_GFP-nb-KS-FtoGDepositorInsertmCherry_P2AT2A_GFP-nb-KS-FtoG
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSV human p85 alpha (HA tag)
Plasmid#11499DepositorAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1A-DIO-PSD95.FingR-eGFP-CCR5TC
Plasmid#126216PurposeLabeling of excitatory synapses (green fluorescence) in cre-expressing neuronsDepositorInsertPSD95.FingR-eGFP-CCR5TC
UseAAV and Cre/LoxExpressionMammalianPromoterEF1AAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFE-Rs-FI-prk
Plasmid#162697PurposeExpresses R. spaeroides Form IC rubisco and S. elongatus PrkDepositorInsertR. spaeroides Form IC rubisco and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRH2502
Plasmid#84379PurposeExpression of dcas9 D10A H840A from a TetR-regulated uvtetO promoterDepositorInsertdcas9
UseCRISPRExpressionBacterialMutationAspartate at position 10 changed to Alanine, Hist…Promoteruv15tetOAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Claspin-Flag
Plasmid#136246PurposeProtein expression of Claspin with a C terminal FLAG tagDepositorInsertClaspin
TagsFlagExpressionMammalianMutationE263G, Q499R, I783T, D932G and S1062G- Please see…Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Z-lock cofilin
Plasmid#141137Purposecontrolling the actin-severing ability of cofilin with lightDepositorInsertZdk2, Cofilin, LOV2
ExpressionMammalianMutationmCherry, Zdk2(132F), Cofilin S3A, LOV WTAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Mito-ExRai-AMPKAR
Plasmid#192448PurposeExRai-AMPKAR targeted to the mitochondrial outer membrane.DepositorInsertMito-ExRai-AMPKAR
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 TEV-GFP-FLAG LIC cloning vector (6LD)
Plasmid#166835PurposeModified LIC 6D backbone with a C-terminal TEV-GFP-FLAG tag. Derived from Scott Gradia's pcDNA3.1 LIC 6D by Liron David.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB
Plasmid#162699PurposeExpresses pHnCB10 derived carboxysome operon and prkDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialPromoterPLtet0-1 promoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only