We narrowed to 14,497 results for: SHR
-
Plasmid#136895PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO2.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY156: SUZ12 px330 sgRNA Cas9 plasmid
Plasmid#170792PurposeThis plasmid encodes Cas9 and a sgRNA that targets the SUZ12 locus; to be used with pDY153DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
p160Tol2-her4.3:switchCas9
Plasmid#227680PurposeExpression of cre inducible and her4.3 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs for SABER-seq in zebrafishDepositorInsertsloxP-dsRed-loxP-Cas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and her4.3Available SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMM113
Plasmid#127210PurposeBeYDV replicon with constitutive Luc expression, WUS2 and AtSTM, sgRNA targeting PDSDepositorInsertWUS2, AtSTM, sgRNA, Luc
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_GBA-4
Plasmid#199274PurposepegRNA used to correct GBA (c. 1226 A > G) mutationDepositorInsertGBA 1226GtoA pegRNA
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTlpA_mCherry_YafQ/DinJ
Plasmid#229148PurposeToxin-Antitoxin (Dinj/YafQ)DepositorInsertmCherry, DinJ/YafQ
ExpressionBacterialPromoterPtlpA (mCherry), DinJ/YafQ (Native)Available SinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS dual_hspCas9
Plasmid#193312PurposeCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS dual sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMM135
Plasmid#127216PurposeBeYDV replicon with constitutive Luc expression, WUS2, sgRNA targeting PDSDepositorInsertLuc, WUS2, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC3
Plasmid#183299PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC3 geneDepositorInsertHDAC3
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT1
Plasmid#183282PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT1 geneDepositorInsertDNMT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB6633
Plasmid#106162PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6677 into Yarrowia lipolytica chromosomal location IntE_1, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMM131
Plasmid#127214PurposeBeYDV replicon with constitutive Luc expression, AtSTM, sgRNA targeting PDSDepositorInsertLuc, AtSTM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-APP-KO
Plasmid#176487PurposeTo knockout APP geneDepositorInsertgRNA sequence
UseCRISPRAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR152
Plasmid#196280PurposeCassette used in dual sgRNA library generationDepositorInserthU6-sgRNA-CR3
UseCRISPR and LentiviralPromoterhU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyC-GFP
Plasmid#220191PurposesgRNA expression vector - pBG42 promoter with GFP in sgRNA siteDepositorInsertpBG42 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG42Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV/MASC_(GLuc)_TOP1
Plasmid#68439PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. CMV/MASC expression backbone.DepositorInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLP16_Lenti Scramble Control
Plasmid#239417PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KODepositorInsertScramble sequence
UseLentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only