We narrowed to 13,645 results for: sequence
-
Plasmid#192850PurposePlasmid to produce ISH probe for mMyh7 gene with UTR sequenceDepositorInsertmyosin heavy chain 7 (Myh7 Mouse)
Available SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3481 MTK3-mCherry
Plasmid#226672PurposeMTK3 part containing the coding sequence of mCherry.DepositorInsertmCherry
UseSynthetic BiologyExpressionMammalianMutationRemoved BbsI sitesPromoternoneAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3445 MTK3-mTagBFP2
Plasmid#226662PurposeMTK3 part containing the coding sequence of mTagBFP2DepositorInsertmTagBFP2
UseSynthetic BiologyPromoternoneAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP6
Plasmid#218245Purpose1) Ectopic expression of MAAP6 protein in mammalian cells. 2) Packaging MAAP6 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 6 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL08V9
Plasmid#218251Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL08V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianPromoterSynapsinAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01
Plasmid#218248Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP9
Plasmid#218246Purpose1) Ectopic expression of MAAP9 protein in mammalian cells. 2) Packaging MAAP9 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-dCas9-FCPF
Plasmid#220133PurposeExpresses dCas9-FCPF in E.coliDepositorInsertdCas9-FCPF (cas9 Synthetic, S. pyogenes)
Tags6xHisExpressionBacterialMutationFCPF sequence inserted on C-terminalPromoterT7Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM-601[insert(+1) TA-rich]
Plasmid#221196Purpose601 nucleosome positioning sequence with an additional base pair inserted 22 nt from the dyad on the TA-rich side of the 601DepositorInsert601[insert(+1)TA-rich]
UseUnspecifiedMutation601 has an additional mutation added 22 bp from d…Available SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMAT_M13_6xSAG
Plasmid#197096PurposeThis plasmid contains the coding sequence for the control peptide M13, which contains a linker with six repeats of serine-alanine-glycine. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CDepositorInsertControl peptide M13, which contains a linker with six repeats of serine-alanine-glycine (SAG)
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-AncSZ
Plasmid#214235PurposeBacterial expression construct of AncSZ, an kinase domain engineered through ancestorial reconstruction of the kinase domains of both SYK and ZAP-70. For in vitro protein tyrosine phosphorylationDepositorInsertSyk kinase (SYK Human)
Tags6xHisExpressionBacterialMutationSequence gained through ancestral reconstruction …PromoterT7Available SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtTAS1c-D2-NbSu-2-AtMIR173a
Plasmid#213401PurposePlant expression vector (2x35S) for expressing a syn-tasiRNA against Nicotiana benthamiana SULFUR gene from AtTAS1c precursorDepositorInsertArabidopsis TAS1c with a syn-tasiRNA sequence at D2 for silencing N. benthamiana SULFUR gene. MIR173 cassette.
ExpressionPlantPromoter2x35SAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC-cUnaG-LPETG
Plasmid#207635PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to C-terminal UnaG fragment and LPETG sortase recognition sequence.DepositorInsertphotocaged SpyCatcher-GGSGGGSG-cUnaG-LPETG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0-EF-54730
Plasmid#202163PurposeLevel 0 plasmid containing a terminator sequence from gene 54730 from Phaeodactylum tricornutum with EF overhangs used to build a level 1 construct.DepositorInsert54730 terminator
UseSynthetic BiologyMutationNoneAvailable SinceSept. 6, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-27877
Plasmid#202110PurposeLevel 0 plasmid containing the promoter from gene 27877 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert27877 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmPAN2-F1103A-dsRNAres_Y
Plasmid#148044PurposeInsect Expression of DmPAN2-F1103A-dsRNAresDepositorInsertDmPAN2-F1103A-dsRNAres (PAN2 Fly)
ExpressionInsectMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmCup_1-417-CG32016-E_T
Plasmid#147583PurposeInsect Expression of DmCup_1-417-CG32016-EDepositorInsertDmCup_1-417-CG32016-E (cup Fly)
ExpressionInsectMutation5 silent and three no silent mutations H117R, N14…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCYFIP1_T
Plasmid#147578PurposeInsect Expression of DmCYFIP1DepositorInsertDmCYFIP1 (Sra-1 Fly)
ExpressionInsectMutation5 silent and one non silent A146V mutations compa…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot1_1-226_R
Plasmid#147416PurposeInsect Expression of DmNot1_1-226DepositorInsertDmNot1_1-226 (Not1 Fly)
ExpressionInsectMutation1 silent mutation compared to the sequence given …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmNot1_1-412_R
Plasmid#147417PurposeInsect Expression of DmNot1_1-412DepositorInsertDmNot1_1-412 (Not1 Fly)
ExpressionInsectMutation1 silent mutation compared to the sequence given …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only