We narrowed to 13,835 results for: CRISPR-Cas9
-
Plasmid#117505PurposeRPS5a:Cas9:E9 Golden Gate Level 1 Position 2 reverseDepositorInsertBpiI:tagt:RPS5a:Cas9_4:E9:ttgc:BpiI
UseCRISPRExpressionPlantPromoterAtRPS5aAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-VEGFA
Plasmid#140588PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA VEGFA
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG1
Plasmid#90276Purpose(also pMST621-BB3_gpyrG1_cas9) CRISPR/Cas9 plasmid with gRNA for pyrG1, Cas9DepositorInsertgRNA (pyrg1)
UseA. nigerExpressionBacterialAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CACNG3
Plasmid#140590PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CACNG3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-ALDH1A3
Plasmid#140589PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA ALDH1A3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-SYNPO
Plasmid#140587PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA SYNPO
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-sbcB-N
Plasmid#220290PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-LbCas12a
UseCRISPR; Gateway compatible sbcb-xten linker- lbca…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-sbcB-N
Plasmid#220305PurposeGateway entry plasmid (attL1& attR5) expressing sbcB exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertsbcB-XTEN linker-zSpCas9
UseCRISPR; Gateway compatible sbcb-xten linker- zspc…ExpressionPlantAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_268
Plasmid#231112PurposeSpG-Cas9DepositorInsertCas9-SpG
UseCRISPR and LentiviralAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-RGS8
Plasmid#140585PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA RGS8
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-GTPBP2
Plasmid#140586PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA GTPBP2
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only