We narrowed to 6,946 results for: crispr cas9 plasmids
-
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Syt1LeftArm-3XGS-GCaMP6s-SV40-3XP3-dsRed-SV40-Syt1RightArm
Plasmid#159636PurposeDonor plasmid for generating Syt1:GCaMP6s strain in Aedes aegypti with CRISPR/Cas9DepositorInsertGCaMP6s
ExpressionInsectAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRhaB-8xHis-ABE8e-eVRQR (LLH551)
Plasmid#242658PurposepRhaB promoter expression plasmid for ABE8e-eVRQR with an N-terminal His8-tagDepositorInsertpRhaB-8xHis-BPNLS-TadA8e-SpCas9(D10A)-eVRQR-BPNLS
UseCRISPRTags8x-HisExpressionBacterialMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterRhaBAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS143
Plasmid#122377PurposeCRISPRi plasmid for use in Candida albicans. Contains dCas9 and NEUT5L integration site and the sgRNA cloning site (SNR52 promoter, PacI sites, sgRNA tail)DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V2
Plasmid#226955PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-RGR-r10
Plasmid#74370PurposeThis plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r10
UseCRISPR and Synthetic BiologyExpressionYeastPromoterADH1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-1
Plasmid#83934PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgALCAM
Plasmid#83929PurposeLentiviral vector expressing an sgRNA targeting ALCAM. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgALCAM
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pY094
Plasmid#84743PurposeExpresses huAsCpf1-T2A-GFP and crRNA guideDepositorInsertshuAsCpf1
GFP
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCCR5
Plasmid#83930PurposeLentiviral vector expressing an sgRNA targeting CCR5 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCCR5
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgTPST2
Plasmid#83933PurposeLentiviral vector expressing an sgRNA targeting TPST2 NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgTPST2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-2
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only