We narrowed to 38,370 results for: NAM
-
Plasmid#226348PurposeExpression of yeast Rpn10 with the UIM deletedDepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pGEM_ΔndhD2.km
Plasmid#185532Purposea pGEM-T easy vector containing the kanamycin resistance cassette flanked by the two regions for the double homologous recombination on the ndhD2 locusDepositorInsertnptII gene flanked by ndhD2 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJB53
Plasmid#226309PurposeE. coli and H. neapolitanus shuttle vector; integrates the gene of interest and a kanamycin resistance marker into a neutral site on the H. neapolitanus genome.DepositorInsertCsoS2 with V(T/S)G to AAA CsoS2 MR1-3
ExpressionBacterialMutationVTG273-5AAA, VTG284-6AAA, VTG295-7AAA, VSG332-4AA…PromoterpTRCAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4666
Plasmid#215271PurposepUPD2 for the Arabidopsis thaliana ABA-responsive MAPKKK18 promoter.DepositorInsertpromMAPKKK18
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBA324
Plasmid#214741PurposeLow copy glmS-nadE plasmid containing kanamycin as antibiotic resistance gene (ARG) for validationDepositorInsertBBa_J23108-RBS(8455)-glmS-RBS(5392)-nadE
ExpressionBacterialAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSV015
Plasmid#214738PurposeLow copy thyA-infA plasmid containing kanamycin as antibiotic resistance gene (ARG) for validationDepositorInsertBBa_J23108-RBS(7504)-thyA-RBS(4427)-infA
ExpressionBacterialAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor_RB-TnV2_pJEx
Plasmid#213908PurposeBarcoded mariner transposon with crystal violet-inducible outward promoter - barcodes can be added via FseI-SbfI restriction sitesDepositorInsertmariner transposon with kan resistance and EilR/pJEx and FseI-SbfI sites for barcode insertion
ExpressionBacterialAvailable SinceFeb. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP10D-HA
Plasmid#209234PurposeMammalian expression of ATP10DDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb713-P2A-GFP
Plasmid#197172PurposeExpresses the protein of mRhubarb713-P2A-GFP in mammalian cellsDepositorInsertmRhubard713-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only