We narrowed to 6,946 results for: crispr cas9 plasmids
-
Plasmid#83935PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgCTRL-3
Plasmid#83936PurposeLentiviral vector expressing a control sgRNA. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgCTRL-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgPLXNB2
Plasmid#86151PurposeCas9/CRISPR plasmid for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPRAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YDR344C
Plasmid#166072PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA targeting intergenic site near HXT6 (within YDR344C) for double stranded break formation in yeast.DepositorInsertIntergenic site near HXT6 (in YDR344C, possible dubious ORF)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-i53-DM
Plasmid#92171Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant that has reverted mutations L69P and V70L (i53-DM)DepositorInserti53-DM
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A, P69L, and L70V mutations and no…PromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTox-EGFPsite1_NGG-PAM (BPK740)
Plasmid#181746Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGG PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGG PAM)
UseSelection plasmidAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTox-EGFPsite1_NGA-PAM (BPK754)
Plasmid#181747Purposep11-lacY-wtx1 derivative toxic plasmid encoding an SpCas9 target site for EGFP site 1 with an NGA PAMDepositorInsertccdB toxin gene and SpCas9 target site (EGFP site 1 NGA PAM)
UseSelection plasmidAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4F2-mCherry
Plasmid#73421PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4F2.DepositorInsertPromoter 4F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3A2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-5F5-mCherry
Plasmid#73422PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 5F5.DepositorInsertPromoter 5F5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP5F5 (orthogonal T7-lac variant)Available SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1D4-mCherry
Plasmid#73423PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1D4.DepositorInsertPromoter 1D4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1D4 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4A6-mCherry
Plasmid#73424PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4A6.DepositorInsertPromoter 4A6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4A6 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only