We narrowed to 16,254 results for: grna
-
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203U-U6-gRNA-pCMV-wtCas9-NG-P2A-mcherry-3'dmDR
Plasmid#221448PurposeExpresses wtCas9-NG with double processed direct repeats (15nt) and a non-target spacer in between at 3' end, mCherry tag, and the gRNA targeting HEK293T-site3DepositorInsertswtCas9-NG
mCherry
UseCRISPRExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
p104Tol2-tp1:Cas9-t2A-GFP, 4xU6:sgRNA
Plasmid#227773PurposeExpression of tp1 (Notch) dependent Cas9-GFP and U6-driven 4 sgRNAs in zebrafishDepositorInsertsCas9-t2A-GFP
4xU6:sgRNA
UseCRISPRPromoterU6 and tp1Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-p120catenin(Canis)-exon4 116-138 gRNA
Plasmid#209923PurposeA knock-out vector for the dog CTNND1DepositorInsertA gRNA targeting the dog CTNND1 gene.
UseCRISPR and LentiviralAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO Chronos-eGFP(with gRNA scaffold)
Plasmid#199582PurposeExpresses Chronos-eGFP in a Cre-dependent mannerDepositorInsertChronos eGFP
UseAAV, CRISPR, and Cre/LoxTagsGFPExpressionMammalianPromoterEF1a intron AAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterSynapsine promoter and U6 promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177365PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expressionDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterCMV and U6 promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-nick sgRNA
Plasmid#214101PurposeLentiviral vector expressing nicking sgRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two sgRNAs using independent U6 promoters.DepositorInsertEGFR L858R nicking sgRNA/EGFR T790M nicking sgRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-recipient_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211688PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and guide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA entry vector - pUC19-U6-[BsmBI_entry]-term (MNW320)
Plasmid#208977PurposeEntry vector for human U6 promoter driven SpCas9-based pegRNAs, comprised of hU6-[BsmBI]-terminator (spacer and RTT/PBS oligos must be cloned in)DepositorInsertpUC19-U6-[BsmBI]-term (pegRNA_entry_vector)
UseCRISPRTagsBPNLSExpressionMammalianPromoterhuman U6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vector
Plasmid#194726PurposeCAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vectorDepositorArticleInsertAsCpf1(D908A)
UseCRISPRExpressionMammalianMutationD908AAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBBK23 pCAS-Tyr-[gRNA: 6=ARS416] (SplitHygR, AmpR)
Plasmid#179007PurposeSp.Cas9 and gRNA yeast expression vector with ARS416 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK17 pCAS-Tyr-[gRNA: 7=HIS3] (SplitKanR, AmpR)
Plasmid#179001PurposeSp.Cas9 and gRNA yeast expression vector with HIS3 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK16 pCAS-Tyr-[gRNA: 6=ARS416] (SplitKanR, AmpR)
Plasmid#179000PurposeSp.Cas9 and gRNA yeast expression vector with ARS416 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only