We narrowed to 9,345 results for: sacs
-
Plasmid#195607PurposeExpresses PI-SceI (VDE) homing endonuclease/intein from the T7 promoterDepositorInsertPI-SceI
ExpressionBacterialMutationC552T,C554A, A557T,G584T, C588A, G878T, C881T, C9…PromoterT7Available SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
NAT-TET-OFF – ubiquitin – LEU – 4MYC
Plasmid#193314PurposeDoxycycline-induced transcriptional regulation and Ubiquitin - LEU - 4xMYC N-terminal tagging. Ubiquitin is cleaved off, resulting in an unstable protein with an N-terminal leucine.DepositorInsertUbiquitin - Leucine - 4MYC N-terminal tagging
Tags4MYCExpressionBacterialAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
HYG-TET-OFF – ubiquitin – LEU – 4MYC
Plasmid#193316PurposeDoxycycline-induced transcriptional regulation and Ubiquitin - LEU - 4xMYC N-terminal tagging. Ubiquitin is cleaved off, resulting in an unstable protein with an N-terminal leucine.DepositorInsertUbiquitin - Leucine - 4MYC N-terminal tagging
Tags4MYCExpressionBacterialAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2Katushka-ter-Hygromycin
Plasmid#184772PurposeRed marker for yeast late Golgi/early endosome. Integration of 2xKatushka tag at SEC7 C terminus. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
PKC1-2GFP-ter-TRP1
Plasmid#184773PurposeIntegration of 2xGFP tag at PKC1 C terminus. Uses auxotrophic marker TRP1(Kluyveromyces lactis).DepositorAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1127B
Plasmid#190997PurposeExpresses arrays of gRNA targeting rel1 promoter under U6b/c promoterDepositorInsertU6b:sgRNArel1A1 - U6c:sgRNArel1A2 - U6b:sgRNArel1A3 - U6c:sgRNArel1A4
ExpressionInsectAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D42
Plasmid#185840PurposeTesting the TEF1 promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[Z268]>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIALD2E
Plasmid#185866PurposeKnocking out ALD6DepositorInsertALD(-125, 40)- ALD6(1054, 1749)
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF71
Plasmid#185860PurposeTesting the SkGAL2 promoter inserted with 4 Z268 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2+[Z268]>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72 (B9)
Plasmid#185858PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 element using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M5(5*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72
Plasmid#185857PurposeTesting the SkGAL2 promoter inserted with 4 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M4(4*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10E1B
Plasmid#185856PurposeTesting the SkGAL2 promoter inserted with 3 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M2(3*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10E1A
Plasmid#185855PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M1(2*PZ4)> (BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (1)
Plasmid#185851PurposeTesting the TEF1 promoter appended with 2 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>2*TcRb>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9358(VII-1_Markerfree_BackBone)
Plasmid#161599PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site VII-1, (Chr VII: 438509..438490)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9359(VIII-1_Markerfree_BackBone)
Plasmid#161600PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site VIII-1, (Chr VIII: 293615..293634)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9361(XIII-1_Markerfree_BackBone)
Plasmid#161602PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XIII-1, (Chr XIII: 306804..306823)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9363(XVI-1_Markerfree_BackBone)
Plasmid#161604PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XVI-1, (Chr XVI: 406267..406286)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB439
Plasmid#185093PurposeNMA111-GFP wild type under control of GAL1 promoter (complements nma111 deletion)DepositorInsertNMA111
TagsGFPExpressionYeastMutationGAL1::NMA111-GFPPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only