We narrowed to 650 results for: atm
-
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHCas9-Nours
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PhoCl AND A-SpyTag
Plasmid#246950PurposeExpresses multifunctional construct for AND-gated release of mCherry from materials in response to 405 nm light AND sortase eSrtA(2A9) treatment. Contains a SpyTag for material tethering.DepositorInsertPlease see depositor comments below
Tags6x His tag, SsrAExpressionBacterialAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_21 tRNA genes
Plasmid#242430PurposeIn vitro transcription of 21 tRNAs after Nt.BspQI treatment. The plasmid contains a T7 promoter upstream and an Nt.BspQI recognition site downstream of each tRNA gene.DepositorInsert21 tRNA genes with a T7 promoter upstream and an Nt.BspQI recognition site downstream of each tRNA gene
ExpressionBacterialAvailable SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pFRT-TODestFLAGHA_RBPMS_KDR_K100E
Plasmid#65093PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with K100E mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchanged lysine 100 to glutamic acid (KDR backgrou…PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_F65A
Plasmid#65092PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with F65A mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
TagsFLAG HAExpressionMammalianMutationchange phenylalanine 65 to alanine (KDR backbone)PromoterCMV, 2x TetAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_nat
Plasmid#184911PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB027
Plasmid#119712PurposeMultipartite assembly obtained by combining FB parts FB026+FB003 into pDGB3omega1. Used for fluorescent tagging of fungi (Hyg resistance +YFP) according to FungalBraid modular DNA assembly for ATMTDepositorInsertPgpdA::YFP::TtrpC(←)-PtrpC::hph::Ttub (→)
UseSynthetic BiologyAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDSM-ab-Psptef1-NAT-Ttip1
Plasmid#127747PurposeYeast pathway position 2. NatMX transcription unit with the S. paradoxus TEF1 promoter and TIP1 terminator. Nourseothricin resistance.DepositorInsertnourseothricin N-acetyltransferase
UseSynthetic BiologyExpressionYeastPromoterPsptef1Available SinceNov. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB012
Plasmid#119709PurposeComplete TU for hygromicin resistance in fungi, domesticated into pUPD2 with AATG/GCTT barcodes. Used for gene KO with dual selection, according to FungalBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -