We narrowed to 132 results for: atm
-
TypeCollection...Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase ATR ATR serine/threonine...
-
Mesothelioma - Causes, Symptoms, and Treatment
TypeBlog Post...mesothelioma treatment As with many forms of cancer, the primary conventional treatments for mesothelioma...than systemic chemotherapy treatments delivered intravenously. New treatment options: Early detection, ...well treatments are working to fight the cancer. Beyond early modifications to standard treatments and...are running out of hope with more traditional treatments, such as surgery, radiation, and chemotherapy... to the fore as a cutting edge form of cancer treatment. With the goal of the Cancer Moonshot Initiative...sufferers can see great promise in up and coming treatments like immunotherapy. Mesothelioma Mesothelioma...not, multiple techniques are used as part of a treatment plan, an approach known as multimodal therapy.... -
Neurodegeneration Plasmid Collection
TypeCollection...-His-ATM wt ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 31986 pcDNA3.1(+) Flag-His-ATM kd ATM... Martins 14542 pLV.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia...173579 Lenti-sgAtm#1/Cre ATM CMV Ataxia telangiectasia Charles Swanton 173580 Lenti-sgAtm#2/Cre ATM CMV Ataxia... ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 32300 hATMS1981A ATM His, Flag CMV Ataxia telangiectasia...Daley 36805 TAL2402 ATM Flag, FOKI CMV Ataxia telangiectasia Keith Joung 36806 TAL2403 ATM Flag, FOKI CMV ...APOE Alzheimer's Sohail Tavazoie 43908 pcDNAFLAG-ATM-kd ATM Flag, His CMV Ataxia telangiectasia Stephen Elledge...Lewy body dementia Tiago Outeiro 89643 Lenti-sgAtm/Cre ATM U6 Ataxia telangiectasia Monte Winslow 89755... -
Validated gRNA Sequences
TypeCollection...TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes... -
Genetic Code Expansion
TypeCollection...non-hydrolyzable phosphoserine Ryan Mehl 218768 ATMW1 Removed endogenous EcTrpRS/ttRNA pair (knocked out...derived from EcNR1 strain) Abhishek Chatterjee 218769 ATMW-BL21 Removed endogenous EcTrpRS/ttRNA pair (knocked...derived from BL21 strain) Abhishek Chatterjee 218770 ATMY1 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218771 ATMY3 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218772 ATMY4 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218773 ATMY5 Removed endogenous EcTyrRS/tRNA pair (tyrS gene ...derived from EcNR1 strain) Abhishek Chatterjee 218774 ATMY-C321 Removed endogenous EcTyrRS/tRNA pair (tyrS ... -
NETRF
TypeCollection...research to discover cures and more effective treatments for carcinoid, pancreatic, and related neuroendocrine...in accelerating progress in the diagnosis and treatment of neuroendocrine cancers. As such, NETRF strongly... -
Neurodegeneration Research Collection
TypeCollection... no cure or way to prevent progression of PD. Treatment consists mainly of managing symptoms through medication...discovery and advance development of diagnostics and treatments for Alzheimer’s disease and related disorders... -
Cancer Research Plasmids and Resources
TypeCollection...are extremely important for classification and treatment. On each pathway page, click on a component to... -
New Tool for Lineage Tracing: The ClonTracer Library
TypeBlog Post...cell populations resistant to drug treatments arise during treatment or are preexisting in the parent population...are resistant to drug treatment and that these are selected for during the treatment process. The authors... population prior to the start of treatment. They hypothesized that, if they labeled the parent cell population...stochastically arise from different cells throughout the treatment regimen and were not preexisting. This was previously...measure their clonal abundance before and after a treatment. The library consists of a pool of lentiviral ...antibiotic resistant cancer cells exist prior to drug treatment. They infected a non-small cell lung cancer cell...library and monitored population dynamics after treatment with EGFR inhibitor, erlotinib. Looking at barcode... -
CRISPR in the Clinic
TypeBlog Post...currently working on giving this treatment a CRISPR spin. CRISPR CAR-T treatments for leukemia, lymphoma, and...particular class of treatments has quite the opposite aim: to destroy. One treatment currently in clinical...almost 10 years later, CRISPR’s potential for treatment is no longer an accurate descriptor; progress ...already approved CAR-T immunotherapy for cancer treatment by traditional gene therapy pipelines (viral),...of its potential for allogenic “off-the-shelf” treatment. In short, instead of using the patient’s own ...which affect hemoglobin. Most of the targeted treatment strategies for these disorders have involved turning...are being finalized, and it is very likely the treatments will be approved for use in the next few months... -
Cancer and the Immune System: Deciphering the Relationship
TypeBlog Post...labor with up and coming immunotherapy treatments. As treatments enter the clinic, physicians and researchers...cause, manifestation, diagnosis, recurrence, and treatment of cancer have been extensively explored. Biologists...known as the tumor microenvironment - a vital atmosphere created by the cancer cells to shield themselves... ability of even these conventional antitumor treatment strategies can be enhanced. Types of immunotherapeutics...Future directions and open questions in cancer treatment We are beginning to see the fruits of many years...researchers are learning much about how treatment regimens can be improved and how the therapies themselves...have occurred during CAR-T cell tests because treatment regimens were not chosen carefully. Participants... -
Antibiotic Resistance: An Old Solution but a New Problem
TypeBlog Post...antibiotics in livestock farming Lengthy courses of treatment with antibiotics These scenarios expose bacterial...considering the other three scenarios, but a short treatment regiment might wipe out bacteria that are completely... susceptible to a drug while a full course of treatment is required to wipe out those bacteria that are...are partially resistant. If you stop a treatment early, you may be un-wittingly selecting for less susceptible...for the drug to work… if the instructions for treatment aren’t followed closely, you could be doing more...the infection is serious or life-threatening, treatment will often begin before this information becomes...expect if a certain antibiotic were chosen for treatment. This is called a Kirby-Bauer disk diffusion test... -
Rett Syndrome
TypeCollection... launched in 2008 to drive the development of treatments and cures for Rett Syndrome and related MECP2... -
Protocol - Bacterial Transformation
TypeProtocol...rearrangement of the plasmid DNA. Additionally, specific treatments have been discovered that increase the transformation... -
Protocol - How to Ligate Plasmid DNA
TypeProtocol... if phosphatase treated, that the phosphatase treatment worked. This control should, in principle, be ... -
Plasmid Cloning by Restriction Enzyme Digest (with Protocols)
TypeProtocol...single enzyme, but this will require phosphatase treatment of your recipient plasmid as well as a specifically... -
Treating Muscular Dystrophy with CRISPR Gene Editing
TypeBlog Post...research conducted on DMD, there is still no good treatment. The dystrophin gene is very large (79 exons),...functional, exon skipping is a good option for DMD treatment. Clinical trials have used oligonucleotide exon... genome editing Since complex oligonucleotide treatment comes with many challenges, researchers have begun...is a good choice for a CRISPR proof of concept treatment, as the disease is especially well suited for ...the technology is advancing, precision editing treatments may also be closer than we might expect. References... -
BeHeard Award 2018: Diseases of Glycosylation, Arginine Mutagenesis, & Neural Development
TypeBlog Post...chemical, guanidine hydrochloride, as a potential treatment for a large number of rare genetic diseases. Spontaneous...GdnHCl was approved by the FDA in 1939 for the treatment of botulism and Lambert-Eaton myasthenic syndrome...GdnHCl could, in principle, provide an effective treatment for rare diseases caused by Arg-mutant proteins...genetic disorders, these will also allow better treatment of these related syndromes. Many thanks and best... -
AAVs in Retinal Gene Therapy
TypeBlog Post...emerging technology and its potential for the treatment of some genetic diseases. I didn’t know it at...approved Luxturna™ the first gene therapy for the treatment of a rare genetic eye disease, Leber’s congenital...may wonder why the first AAV-based gene therapy treatment for a genetic disease approved by the FDA is for...Lancelot, one of the dogs who received the AAV-RPE65 treatment, famously visited Congress to help increase awareness... -
CRISPR Antimicrobials
TypeBlog Post...hospital-borne infection. Two rounds of phagemid treatment were sufficient to wipe out the virulent strain...strain. Bacteria not killed by the first round of treatment either did not receive a phagemid, lost the phagemid... In a mouse skin colonization model, phagemid treatment decreased the proportion of virulent S. aureus... cells could repopulate the environment after treatment. The phagemid systems used in both papers are ...