We narrowed to 980 results for: trna
-
Plasmid#99219PurposeComplementary plasmid for aaRS PACE; amber codons in T7 RNAPDepositorInsertPpsp [SD8] T7RNAP(S12*,S203*,S527*)
Mutationamber codons at positions 12, 203, and 527 of T7 …PromoterPpspAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDB036a
Plasmid#99215PurposeAccessory plasmid for PACE of MjTyrRS variants; negative selectionDepositorInsertPpsp [SD8] gIII; PproK tyrT(Opt,CUA); PproD [SD4] T7RNAP(S12*,S203*)
ExpressionBacterialMutationamber codons at positions 12 and 203 of T7 RNA po…PromoterPpsp, PproK and PproDAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IARS2-tb
Plasmid#232340PurposeExpresses human IARS2 with synonymous mutations (to prevent recognition by siRNA) in mammalian cellsDepositorInsertIARS2 (IARS2 Human)
ExpressionMammalianMutation5 synonymous mutations in the siRNA (ACUUGCAGUCAU…PromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDB026a
Plasmid#109260PurposeAccessory plasmid for PACE of MjTyrRS variantsDepositorInsertPpsp_pIII(P29*); luxAB; PproK_TyrT(Opt, CUA);
ExpressionBacterialMutationamber codon at position 29 gIIIPromoterPpsp; PproKAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
MARS_pNIC-CTB10H
Plasmid#153053PurposeExpression construct for producing Avi tagged Methionyl-tRNA synthetaseDepositorAvailable SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
AARS_C2_pNIC-Bio3
Plasmid#153047PurposeExpression construct for producing Avi tagged Alanyl-tRNA synthetaseDepositorAvailable SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTH644-CENBEVY
Plasmid#29695DepositorInsertbidirectional promoter cassette from pBEVY-U
ExpressionYeastAvailable SinceJan. 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK lpp MaPylT glnS ASV
Plasmid#253745PurposePlasmid encoding mutant M alvus pyrrolysyl synthetase-ASV and tRNA for m-iodophenylalanineDepositorInsertsM. alvus pyrrolysyl synthetase-ASV
tRNAMaPyl
ExpressionBacterialMutationL125A, N166SAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK lpp MaPylT glnS LAC
Plasmid#253743PurposePlasmid encoding mutant M alvus pyrrolysyl synthetase-LAC and tRNA for m-iodophenylalanineDepositorInsertsM. alvus pyrrolysyl synthetase-LAC
tRNAMaPyl
ExpressionBacterialMutationN166A, V168CPromoterglnS and lppAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK lpp MaPylT metG ASV
Plasmid#256311PurposePlasmid encoding mutant M alvus pyrrolysyl synthetase-ASV and tRNA for o-cyanophenylalanineDepositorInsertsM. alvus pyrrolysyl synthetase
tRNAMaPyl
ExpressionBacterialPromoterlpp and metGAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK lpp MaPylT glnS LSV
Plasmid#253744PurposePlasmid encoding mutant M alvus pyrrolysyl synthetase-LSV and tRNA for m-iodophenylalanineDepositorInsertsM. alvus pyrrolysyl synthetase-LSV
tRNAMaPyl
ExpressionBacterialMutationN166SAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBK lpp MaPylT glnS AST
Plasmid#255035PurposePlasmid encoding mutant M alvus pyrrolysyl synthetase-AST and tRNA for o-nitrophenylalanineDepositorInsertsM. alvus pyrrolysyl synthetase-AST
tRNAMaPyl
ExpressionBacterialMutationL125A, N166S, V168TAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
L-NARS-2
Plasmid#166532PurposescFv of a human scaffold targeting Asparaginyl-tRNA synthetase. Antigen coverage aa 1-458 of 458, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
O-AARS-51
Plasmid#166539PurposescFv of a human scaffold targeting Alanyl-tRNA synthetase. Antigen coverage aa 1-455 of 968DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-TARS-11
Plasmid#166536PurposescFv of a human scaffold targeting Threonyl-tRNA synthetase. Antigen coverage aa 320-723 of 723DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-WARS-26
Plasmid#166528PurposescFv of a human scaffold targeting Tryptophanyl-tRNA synthetase. Antigen coverage aa 1-1471 of 471, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only