We narrowed to 11,379 results for: ENA
-
Plasmid#146057PurposeInsect Expression of DmTral-R21EE23KS13AI15ADepositorInsertDmTral-R21EE23KS13AI15A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21EF44A_C
Plasmid#146058PurposeInsect Expression of DmTral-R21EF44ADepositorInsertDmTral-R21EF44A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21ER42EF44A_C
Plasmid#146059PurposeInsect Expression of DmTral-R21ER42EF44ADepositorInsertDmTral-R21ER42EF44A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21ES13AI15A_C
Plasmid#146060PurposeInsect Expression of DmTral-R21ES13AI15ADepositorInsertDmTral-R21ES13AI15A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-S13AI15A_C
Plasmid#146062PurposeInsect Expression of DmTral-S13AI15ADepositorInsertDmTral-S13AI15A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-S70AD71K_C
Plasmid#146063PurposeInsect Expression of DmTral-S70AD71KDepositorInsertDmTral-S70AD71K (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-LSm-D30KT35A-V5His6_C
Plasmid#146067PurposeInsect Expression of DmTral-LSm-D30KT35ADepositorInsertDmTral-LSm-D30KT35A (tral Fly)
ExpressionInsectMutationone silent mutation A198C compared to the sequenc…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-D30KT35A_C
Plasmid#146042PurposeInsect Expression of DmTral-D30KT35ADepositorInsertDmTral-D30KT35A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-del46-60_C
Plasmid#146043PurposeInsect Expression of DmTral-del46-60DepositorInsertDmTral-del46-60 (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-F44A_C
Plasmid#146044PurposeInsect Expression of DmTral-F44ADepositorInsertDmTral-F44A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-K73AD74A_C
Plasmid#146045PurposeInsect Expression of DmTral-K73AD74ADepositorInsertDmTral-K73AD74A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R42E_B
Plasmid#145988PurposeInsect Expression of DmTral-R42EDepositorInsertDmTral-R42E (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_BACH1_Y11A
Plasmid#159131PurposeExpresses BACH1 in mammalian cellsDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
ExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g1)-PGKpuroBFP-W
Plasmid#105028PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g2)-PGKpuroBFP-W
Plasmid#105029PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g1)-PGKpuroBFP-W
Plasmid#105035PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only