We narrowed to 7,067 results for: FIE
-
Plasmid#62031Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only
-
psicheck_NDUFA6_3UTR_mut
Plasmid#65971PurposeLuciferase assay vector, assessing regulation of NDUFA6 3' UTR, with two mutated tandem CAC motifsDepositorAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Mouse Nanog locus 3' probe
Plasmid#60037PurposeCloned genomic fragment of murine Nanog locus used as probe for Southern Blot analysisDepositorInsertNanog (Nanog Mouse)
UseUnspecified; CloningAvailable SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSC-hXRCC1-IntE2
Plasmid#52276PurposeBacterial expression of human XRCC1 C-terminally fused to GyrA intein, SUMO-E2 and GSTDepositorAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
JMJD2C
Plasmid#38974PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pCAGGS-HA-UBA7-V548L
Plasmid#246473PurposeMammalian expression of HA-tagged human UBA7-V548L; for transfectionDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-HA-UBA7-K709Sfs
Plasmid#246474PurposeMammalian expression of HA-tagged human UBA7-K709Sfs; for transfectionDepositorAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGB-OCS terminator-SunTag-HA-dCas9-NLS
Plasmid#246798PurposeA GreenGate entry vector containing NLS-dCas9-HA-SunTag fused gene followed by a OCS terminatorDepositorInsertNLS-dCas9-HA-SunTag-OCS terminator
UseGreengate cloning entry vectorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos5a
Plasmid#233461PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b
Plasmid#233464PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b, ColE1 ori, and KanR.
UseCRISPRAvailable SinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXJ-His-CD80
Plasmid#232665Purposetransient expresses CD80 in mammalian cellsDepositorAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest-pol2-Smarcd1-Myc
Plasmid#227716PurposeExpresses mouse Smarcd1 protein with a Myc tag from a Pol2 promoter. Has a Blasticidin resistance gene for stable cell line generation and Ampicilin for plasmid propagation.DepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR/eCas9-GPIDAF
Plasmid#213710PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of eCas9 and the affinity sorting tag TST-EGFP-GPIDAF under separate promoters.DepositorInsertEGFP
UseCRISPRTags3XFLAG and Twin-strep-tagPromoterCMVAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmATM
Plasmid#208392PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ATM gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmMLKL
Plasmid#208391PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine MLKL gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR95
Plasmid#203916PurposeBLINCAR plasmid for gene deletion, no genomic targetDepositorInsertmodified MCS
ExpressionYeastAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dendra-Rab11a
Plasmid#184038PurposeExpresses red to green photoconvertible Rab11aDepositorAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only