We narrowed to 9,829 results for: CAG
-
Plasmid#76095Purpose3rd generation lentiviral gRNA plasmid targeting human BRD3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PDGFRA gRNA (BRDN0001148373)
Plasmid#75493Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-GW1D1b(aa502-751)
Plasmid#21521DepositorPublicationAvailable sinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
mGluR6 (200bp crit reg+SV40 bas prom)-LacZ
Plasmid#18806DepositorInsertmGluR6 (200bp crit reg+SV40 bas prom)-LacZ
ExpressionMammalianAvailable sinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: ATCAGTGATAGAGAACGTATGAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g2)-PGKpuroBFP-W
Plasmid#105038PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Target Zfp462-Klf4SE
Plasmid#127668PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter; 2 gRNAs targeting the Zfp462 promoter and 2 gRNAs targeting the Klf4 SE expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 129, 135, 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MARK2 gRNA (BRDN0001146902)
Plasmid#77592Purpose3rd generation lentiviral gRNA plasmid targeting human MARK2DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001145195)
Plasmid#77550Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CAMK2A gRNA (BRDN0001162256)
Plasmid#76929Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK2ADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA3 gRNA (BRDN0001147883)
Plasmid#76743Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK1 gRNA (BRDN0001145902)
Plasmid#76746Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1A gRNA (BRDN0001148321)
Plasmid#76754Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1ADepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K3 gRNA (BRDN0001147291)
Plasmid#76379Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K3 gRNA (BRDN0001146677)
Plasmid#76380Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MINK1 gRNA (BRDN0001146260)
Plasmid#76260Purpose3rd generation lentiviral gRNA plasmid targeting human MINK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP4K4 gRNA (BRDN0001146036)
Plasmid#76265Purpose3rd generation lentiviral gRNA plasmid targeting human MAP4K4DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP4K4 gRNA (BRDN0001162353)
Plasmid#76266Purpose3rd generation lentiviral gRNA plasmid targeting human MAP4K4DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only