We narrowed to 39,830 results for: KAN;
-
Plasmid#178882PurposeExpression of human codon-optimized NlaCas11 with N terminal NLS and HA tagDepositorInsertEF1a-NlaCas11c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas7
Plasmid#178879PurposeExpression of human codon-optimized Nlacas7 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas7c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBC155
Plasmid#202274PurposeLevel 2 for strain-specific barcode DNA tag with bc182 through Tn7 bacterial insertion, Spectinomycin and Streptomycin selectable marker and tagBFP fluorescent markerDepositorInsertbc182
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC114
Plasmid#202276PurposeLevel 2 for strain-specific barcode DNA tag with bc141 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc141
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHC01
Plasmid#106900PurposeRatiometric gas biosensor plasmid for 3-oxo-C12-HSL sensingDepositorInsertsLasR
Methyl Halide Transferase
Ethylene Forming Enzyme
Red Fluorescent Protein
ExpressionBacterialAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICH67131
Plasmid#153223PurposeLevel 1 position 1 containing the Nos promoter, NPTII (Kan resistance), and the Nos terminatorDepositorInsertNos promoter, NPTII, Nos terminator
UseSynthetic BiologyAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pconst #5-RFP
Plasmid#81079Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23110Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pconst #4-RFP
Plasmid#81078Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23107Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pconst #1-RFP
Plasmid#81075Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23119Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-eGFP-NT1-6-gix-6-NT1
Plasmid#81204Purposecontains two target sites consisting of PAM-NT1-6bp-gix psuedo site-6bp-NT1-PAM flanking a kan/pA as previously described in the pCALNL-eGFP plasmidDepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-APEX2-mCherry
Plasmid#188944PurposeMiddle entry vector for Gateway cloning containing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherryDepositorInsertmito-APEX2_p2A_APEX2-H2B_p2A_mCherry
UseMiddle entry vector for gateway (l1-l2)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pconst #3-RFP
Plasmid#81077Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter - BBa_J23101Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pconst #2-RFP
Plasmid#81076Purposeconstitutive promoter expressing RFP, biobrick constructionDepositorInsertRFP
UseP15a origin, constitutive promoter, kanrPromoterConstitutive Promoter- BBa_J23104Available SinceAug. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBER
Plasmid#62662PurposeDonor vector for tdTomato knock-in via landing padDepositorInsertstdTomato
hygromycin
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGX
Plasmid#62666PurposeDonor vector for Dre knock-in via landing padDepositorInsertDre
UseCre/LoxAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGO
Plasmid#62671PurposeDonor vector for mFTH1 knock-in via landing padDepositorInsertFTH1
UseCre/LoxTagsHAExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKEK3235
Plasmid#234107PurposeCCP expression in diverse gram-negative bacteria, with pre-cloned Golden Gate Compatible (BsaI) restriction sites to facilitate promoter swapping.DepositorInsertsfGFP
TagsFLAGExpressionBacterialMutationS30R/Y39N/N105T/Y145F/I171V/A206VPromoterpJ23100-BsaIAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBC135
Plasmid#202262PurposeLevel 2 for strain-specific barcode DNA tag with bc162 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc162
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC113
Plasmid#202275PurposeLevel 2 for strain-specific barcode DNA tag with bc140 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc140
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC115
Plasmid#202277PurposeLevel 2 for strain-specific barcode DNA tag with bc142 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc142
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC117
Plasmid#202278PurposeLevel 2 for strain-specific barcode DNA tag with bc144 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc144
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC118
Plasmid#202279PurposeLevel 2 for strain-specific barcode DNA tag with bc145 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc145
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC119
Plasmid#202280PurposeLevel 2 for strain-specific barcode DNA tag with bc146 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc146
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC108
Plasmid#202247PurposeLevel 2 for strain-specific barcode DNA tag with bc135 through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc135
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC160
Plasmid#202248PurposeLevel 2 for strain-specific barcode DNA tag with bc187 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc187
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC161
Plasmid#202249PurposeLevel 2 for strain-specific barcode DNA tag with bc188 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc188
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC162
Plasmid#202250PurposeLevel 2 for strain-specific barcode DNA tag with bc189 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc189
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC124
Plasmid#202251PurposeLevel 2 for strain-specific barcode DNA tag with bc151 through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertbc151
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC125
Plasmid#202252PurposeLevel 2 for strain-specific barcode DNA tag with bc152 through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertbc152
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC127
Plasmid#202254PurposeLevel 2 for strain-specific barcode DNA tag with bc154 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc154
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC128
Plasmid#202255PurposeLevel 2 for strain-specific barcode DNA tag with bc155 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc155
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC129
Plasmid#202256PurposeLevel 2 for strain-specific barcode DNA tag with bc156 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc156
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC130
Plasmid#202257PurposeLevel 2 for strain-specific barcode DNA tag with bc157 through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc157
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC131
Plasmid#202258PurposeLevel 2 for strain-specific barcode DNA tag with bc158 through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc158
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC132
Plasmid#202259PurposeLevel 2 for strain-specific barcode DNA tag with bc159 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc159
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC133
Plasmid#202260PurposeLevel 2 for strain-specific barcode DNA tag with bc160 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc160
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC134
Plasmid#202261PurposeLevel 2 for strain-specific barcode DNA tag with bc161 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc161
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC069
Plasmid#202233PurposeLevel 2 for strain-specific barcode DNA tag with bc096 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc096
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC070
Plasmid#202234PurposeLevel 2 for strain-specific barcode DNA tag with bc097 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc097
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC071
Plasmid#202235PurposeLevel 2 for strain-specific barcode DNA tag with bc098 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc098
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC072
Plasmid#202236PurposeLevel 2 for strain-specific barcode DNA tag with bc099 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc099
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC073
Plasmid#202237PurposeLevel 2 for strain-specific barcode DNA tag with bc100 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc100
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC079
Plasmid#202238PurposeLevel 2 for strain-specific barcode DNA tag with bc106 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc106
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC080
Plasmid#202239PurposeLevel 2 for strain-specific barcode DNA tag with bc107 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc107
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC081
Plasmid#202240PurposeLevel 2 for strain-specific barcode DNA tag with bc108 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc108
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC082
Plasmid#202241PurposeLevel 2 for strain-specific barcode DNA tag with bc109 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc109
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC083
Plasmid#202242PurposeLevel 2 for strain-specific barcode DNA tag with bc110 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc110
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC104
Plasmid#202243PurposeLevel 2 for strain-specific barcode DNA tag with bc131 through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc131
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only