We narrowed to 1,487 results for: aav vector plasmid
-
Plasmid#120301PurposeAAV vector for expression of AcrIIC3 (no miR binding sites, control vector)DepositorInsertAcrIIC3
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC1-scaffold (2xBsmBI sites)
Plasmid#120300PurposeAAV vector for expression of AcrIIC1 (no miR binding sites, control vector)DepositorInsertAcrIIC1
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA
Plasmid#190163PurposeMicroglia-targeted transgene expression.DepositorInsertsmIba1 promoter, 1.7-kb, microglia-specific promoter
miR-9-Tx4, 4 repeated miRNA target sites for miR-9
miR-129-2-3p-Tx4, 4 repeated miRNA target sites for miR-129-2-3p
UseAAVAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-minBG-CI-mRuby2-W3SL-T7
Plasmid#231353PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from minBG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-tdTomato-W3SL-T7
Plasmid#231356PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses tdTomato from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CMVp-CI-mRuby2-W3SL-T7
Plasmid#231357PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from CMV promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-Ef1s-CI-mRuby2-W3SL-T7
Plasmid#231358PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from Ef1s promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-SCP1-CI-mRuby2-W3SL-T7
Plasmid#231359PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses mRuby2 from SCP1 promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.T7-SP6-BC(p11-14)-CAG-EGFP-W3SL-T7
Plasmid#231348PurposeSingle stranded AAV genome with barcodeless T7 RNA polymerase promoter and SP6-driven barcode, for tracking AAV concatemers via SpECTr. Also expresses EGFP from CAG promoter.DepositorInsertT7-SP6-BC(p11-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVf-EnhCB-lacZnls mir-122 1xBS
Plasmid#35643DepositorInsert1 miR-122 target site
UseAAVPromoterCBAvailable SinceApril 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hDlx_DIO_ChR2_mCherry
Plasmid#224459PurposeAn AAV vector expressing ChR2-mCherry that is dependent on both Cre and the hDlx enhancerDepositorInsertChR2-mCherry
UseAAVExpressionMammalianAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.cTNT.iCre
Plasmid#69916PurposeUsed to package AAV9:cTNT.iCre, which specifically transduce cardiomyocytes and express Cre recombinase. Only works in vivo.DepositorHas ServiceAAV9Insertimproved cre (iCre) recombinase and tdTomato
UseAAVTagsThe iCre coding frame and tdTomato coding frame i…PromoterChicken cardiac troponin TAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV2_CAG_oROS-G
Plasmid#216115PurposeEncodes the genetically encoded, green fluorescent peroxide sensor oROS-G in AAV viral vectors.DepositorInsertoROS-G
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_SC_4.26_STARR-seq
Plasmid#220220PurposeAAV-STARR-seq screening vector with 4.26 promoteDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoter4.26Available SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-Tyr
Plasmid#135616PurposeDonor vector for genomic targeting of an EcoRI restriction site to the mouse Tyrosinase locusDepositorInsertEcoRI restriction site flanked by Tyr homology arms (Tyr Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS1830 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-U6-Fah
Plasmid#199263PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one U6 driven sgRNA targeting the point mutation in the mouse Fah gene of a HT1 mouse modelDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianPromoterU1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-cfGFP
Plasmid#200773PurposeExpresses cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas ServiceAAV8Insertcysteine-free GFP
UseAAVPromoterSynapsinAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only