We narrowed to 2,521 results for: crispr system
-
Plasmid#101740Purposeexpression of an optimized Cas9 for base-editing in zebrafishDepositorInsertrAPOBEC1-XTEN-zCas9(VQR)-UGI-NLS
UseCRISPRExpressionMammalianMutationD10A, VQR mutationsPromoterCMVAvailable SinceJan. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
AsdCas12a VPR
Plasmid#188512PurposeExpresses FLAG tagged AsdCas12a VPRDepositorInsertdCas12a
UseCRISPR and LentiviralExpressionMammalianMutationD908APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sa-dCas9-NLS-3xFLAG/pcDNA3.1
Plasmid#98041PurposeExpresses Sa-dCas9-NLS-3xFLAG in mammalian cells for enChIP analysis to purify specific genomic regions of interestDepositorInsertSa-dCas9-NLS-3xFLAG
UseCRISPRTags3xFLAG tag and NLS (nuclear localization signal)ExpressionMammalianMutationD10A + H557APromoterCMVAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMK-Cas9-gate
Plasmid#113743PurposeGateway destination vector encoding Maize ubiquitin promoter driving Cas9 and 35S promoter driving aminoglycoside phosphotransferase for G418 selection in plants.DepositorInsertCas9
UseCRISPR and Gateway CloningPromoterZ. Mays ubiquitin promoter, 35S promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
A3Bctd-max
Plasmid#198888PurposeExpress A3Bctd-max BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
Tags6x His and NLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
HiFi dCas9 KRAB
Plasmid#188500PurposeExpresses FLAG tagged HiFi dCas9 KRABDepositorInsertdCas9
UseCRISPR and LentiviralExpressionMammalianMutationD10A/R691A/H840APromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL0374 (His-MBP-Cas8_Cas7_Cas6)
Plasmid#130639PurposeExpresses V. cholerae CAST Cas8, Cas7, and Cas6 from a T7 promoter, with N-terminal His10-MBP-TEVsite tag on Cas8 for purification.DepositorInsertVchCas8, VchCas7, VchCas6
UseCRISPR; TransposonTagsHis10-MBP-TEVsite on Cas8ExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
OmEF1aCas9P2ApuroSB
Plasmid#165484PurposeStable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cellsDepositorInsertZebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
UseCRISPR; TransposonPromoterOreochromis mossambicus EF1 alpha promoter (OmEF1…Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL0373 (His-MBP-TniQ)
Plasmid#130638PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite tag for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3B-Cas9n-UGI-NLS
Plasmid#198889PurposeExpress full-length A3B BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0008
Plasmid#42248PurposegRNA targeted to zebrafish gene tia1lDepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSL0721 (pDonor_L1-105)
Plasmid#130645PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened left end. Total transposon size = 933 bp.DepositorInsertVchCAST donor DNA (short L)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0376 (His-MBP-StrepII-TniQ)
Plasmid#130641PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite-StrepII for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite-StrepII on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0715 (pDonor_R1-57)
Plasmid#130644PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened right end. Total transposon size = 910 bp.DepositorInsertVchCAST donor DNA (short R)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTX208
Plasmid#89268PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02DepositorInsertOsYSA-gRNA01 and OsYSA-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only