We narrowed to 7,534 results for: ski
-
Plasmid#169319PurposeGateway entry vector for human VPS4A ORFDepositorAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only
-
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-NES-ZapCV2 (cpV143)
Plasmid#112060PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)DepositorInsertNES-ZapCV2
TagsNuclear Export Signal (NES) derived from HIV-1ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…PromoterCMVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28-Dnmt3a3L-sc27
Plasmid#71827PurposeFor bacterial expression of Dnmt3a-Dnmt3L single-chain fusion protein protein. Contains the catalytic domain of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L connected by 27 aa linker.DepositorInsertDnmt3a catalytic domain (M. musculus) Dnmt3L (M. musculus) C-terminal domain gene fusion (Dnmt3a Mouse)
Tags6xHis tagExpressionBacterialAvailable SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-LIG1
Plasmid#215131PurposeExpresses mCherry-LIG1 in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-control
Plasmid#216857PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing transcript at the synapse. CIRTS-YTHDF2-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_MDS1
Plasmid#45258DepositorAvailable SinceJune 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.iAChSnFR-Venus
Plasmid#137959PurposeExpresses FLEXed iAChSnFR (yellow version) under CAG promoterDepositorArticleInsertiAChSnFR (yellow variant)
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO SF-HERC2 C4762S (ShB-R)
Plasmid#55614PurposeDox-inducible expression of full length, ShB-resistant, 3xFLAG/STREP tagged C4762S (catalytically inactive) HERC2 in Flp-In T-Rex cellsDepositorInsert3xFLAG tagged HERC2 (C4762S) (HERC2 Human)
Tags3xFLAG and STREPExpressionMammalianMutationC4762 mutated to serine to render HERC2 catalytic…Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.G333C
Plasmid#82835PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_AKR1B1_WT_V5
Plasmid#82953PurposeGateway Donor vector containing AKR1B1, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCjeCas9
Plasmid#172215PurposeExpresses Campylobacter jejuni Cas9 (CjeCas9) in bacterial cellsDepositorInsertCas9 endonuclease from the Campylobacter jejuni Type II CRISPR/Cas system
TagsHistagPromoterT7Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-MPP8-10xHis
Plasmid#194178PurposeExpresses MPP8-10xHis taggedDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ARAF_WT
Plasmid#82900PurposeGateway Donor vector containing ARAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000338462
Plasmid#78158PurposeshXPO1 targeting CDSDepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TERT_p.L593F
Plasmid#82856PurposeGateway Donor vector containing TERT, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR 223 VPS4B
Plasmid#169320PurposeGateway entry vector for human VPS4B ORFDepositorAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iAChSnFR-NULL
Plasmid#137956PurposeExpresses iAChSnFR (non-binding variant) under CAG promoterDepositorArticleInsertiAChSnFR (non-binding variant)
UseAAVExpressionMammalianMutationY140A binding site mutantPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
p21-HA-NeoR
Plasmid#215104PurposeExpresses p21-HA in mammalian cells.DepositorAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only