We narrowed to 8,762 results for: sgrna
-
Plasmid#223374PurposeT-DNA vector for SpCas9 mediated mutagenesis for plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Frodo-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210734PurposeCoding for SaSp D10A Cas9 alongside Frodo sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Frodo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p8391 LentiCRISPRv2 Neo sgPTPN14-1
Plasmid#221651PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-1 (PTPN14 Human)
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8392 LentiCRISPRv2 Neo sgPTPN14-3
Plasmid#221652PurposeExpression of sgRNA targeting the locus of human PTPN14DepositorInsertsgPTPN14-3 (PTPN14 Human)
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRhaCAST
Plasmid#211791PurposepZLrhaB2plus with Sh-cas12K-tnsBC-tniQ cloned into, which drives by the rhamnose inducible promoterDepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning
UseCRISPRExpressionBacterialPromoterRhamnose-inducibleAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Merry-eCMV-SaSpD10A+linker (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210736PurposeCoding for SaSp D10A Cas9 alongside Merry sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Merry sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Gollum-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210735PurposeCoding for SaSp D10A Cas9 alongside Gollum sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Gollum sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-sgHPRT1
Plasmid#196713PurposeCRISPR-KO. WT-SpCas9 and sgRNA targeting HPRT1. Editing-competent cells can be selected with 6-TGDepositorInsertCas9-T2A-BSD-U6-sgHPRT1
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1a/hU6Available SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-U6-sgGFP
Plasmid#190899PurposeAAV vector expressing sgGFPDepositorInsertsgRNA
UseAAV and CRISPRPromoterU6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-doraWT_rescue_construct
Plasmid#190608PurposePuromycin-selectable expression of HA-tagged Dora (CG34401) in Drosophila S2 cellsDepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR: pmU6 sgChr3q29 2xMS2 pUbC MCP-mCherry-p2a-Puro
Plasmid#174118PurposeExpression of sgRNA targeting Chr3q29 (chr3: 195478317 - 195506985, hg38)DepositorInsertsgChr3q29 2xMS2 and MCP-mCherry-p2a-Puro
UseLentiviralPromotermU6 and UbCAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX300A-G+Nanog
Plasmid#140280PurposeCRISPR/Cas9 plasmid encoding Cas9 and sgRNA against gBait and Nanog locusDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2750
Plasmid#135094PurposeSite specific CRISPR/Cas9 editing of C. elegans Chr IVDepositorInsertsgRNA for cxTi10082 (actgttggatgcctgtgtag)
UseCRISPRExpressionWormPromoterU6Available SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA2963_eSpCas9-PGKHygdtkCh
Plasmid#124205PurposeExpression of eSpCas9(1.1) and sgRNADepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCF704
Plasmid#121658PurposeU6-sgRNA EFS-ProCas9-Flavi-P2A-PuroDepositorInsertCas9(C)
UseLentiviralPromoterU6Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only