We narrowed to 46,018 results for: cha
-
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB(C460S)
Plasmid#183677PurposeRecombinant Salmonella Typhimurium SopB (catalytically inactive)DepositorInsertsopB (sopB Budding Yeast, Salmonella enterica serovar Typhimurium)
TagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialMutationC460SPromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st&2nd WW mutant
Plasmid#19000DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
ExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xnr UAS ifgMosaic Donor vector (IG230)
Plasmid#99631PurposeTo clone the 3 ORFs for Gal4 dependent generation of ifgMosaicsDepositorInsertN-PhiM
UseCre/LoxAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Triple ORF FRT ifgMosaic Donor (IG135)
Plasmid#99626PurposeTo clone the 3 ORFs for FlpO dependent generation of ifgMosaicsDepositorInsertPGK-Neo
UseCre/Lox, Mouse Targeting, and Synthetic BiologyAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAWp28-v1 scaffold
Plasmid#157976PurposepBT264-U6p-{2xBbsI}-v1 sgRNA scaffold-{MfeI} Note: This plasmid is unstable. Screen multiple colonies to identify full length clones.DepositorTypeEmpty backboneAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*mqg*
Plasmid#21174DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-GFP-PGK-Puro
Plasmid#110865PurposeLentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL2-WPRE-UbC-Emerald
Plasmid#225945PurposeLentiviral vector plasmid expressing human atlastin GTPase 2 (ATL2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJTB115
Plasmid#248909PurposeExpresses yeast Smk1 and Ssp2 fused to glutathione-S-transferase in bacteriaDepositorInsertsSMK1 Mitogen-activated Protein Kinase (SMK1 Budding Yeast, Sequence is from the SK1 isolate of S. cerevisiae and will differ by 1 non-synonomous/several synonymous changes)
Ssp2 (SSP2 Budding Yeast, Sequence is from the SK1 isolate of S. cerevisiae and may differ by synonymous changes from S288C form)
Tagsglutathione-S-transferaseExpressionBacterialMutationNdeI and NcoI sites were removed for cloning purp…PromoterT7Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGL4-CMV-myc-XPO1
Plasmid#242469PurposeExpresses human XPO1 protein with an N-terminal cMyc tag.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-CMV-FLAG-XPO1
Plasmid#242459PurposeExpresses human XPO1 with an N-terminal FLAG tag for pull-down assays.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Strep-His-Tev-hCGNL1
Plasmid#236520PurposeFor expression of Paracingulin (human) in insect cellsDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-cCGNL1-Myc
Plasmid#236516PurposeFor expression of Paracingulin (dog) in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only