We narrowed to 23,663 results for: c-myc
-
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_empty_gRNA
Plasmid#197557Purposesites for cloning two gRNA with puromycin cassetteDepositorTypeEmpty backboneUseEmpty grna backbone with puromycin resistance geneExpressionMammalianPromoterU6 for gRNA, CMV for puromycin resistance.Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM_Δflv3.sm
Plasmid#185533Purposea pGEM-T easy vector containing the streptomycin/spectinomycin resistance cassette flanked by the two regions for the double homologous recombination on the flv3 locusDepositorInsertaadA gene flanked by flv3 upstream and downstream regions
UseSynthetic BiologyAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
Cas12aUltra_5XNLS
Plasmid#218775PurposeHis-TEV-Cas12aUltra-BPSV40_cMyc_NP_5NLSDepositorInsert5xNLS-BPSV40-NLP-cMyc-cMyc-BPSV40- AspCas12a
UseCRISPRTags6XHis (C terminal), HA, Nucleoplasmin, SV40, and …ExpressionBacterialMutationNucleotides mutations were made to encode for arg…Available SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-PIWI(aa478-860)
Plasmid#21543DepositorAvailable SinceJuly 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
FLAG-PAZ(aa1-480)
Plasmid#21529DepositorAvailable SinceJuly 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-GAP-ACS1
Plasmid#126712Purposeyeast plasmid complementing ACS1 from Komagataella phaffiiDepositorInsertacs1
Tags6xHis,MycExpressionYeastPromoterGAPAvailable SinceJune 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[C399-625]-Gwpep(Mm)
Plasmid#188589PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertGW-peptide (mouse) C-terminally tagged C-terminal domain of Nibbler
TagsFLAG-Myc and GWpep mmExpressionInsectAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[C399-625]-Gwpep(Dm)
Plasmid#188590PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertGW-peptide (drosophila) C-terminally tagged C-terminal domain of Nibbler
TagsFLAG-Myc and Gwpep dmExpressionInsectAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-GAP-ALD1
Plasmid#126711Purposeyeast plasmid complementing ALD1 from Komagataella phaffiiDepositorInsertald1
Tags6xHis,MycExpressionYeastPromoterGAPAvailable SinceJune 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-GAP-ADH3
Plasmid#126710Purposeyeast plasmid complementing ADH3 from Komagataella phaffiiDepositorInsertadh3
Tags6xHis,MycExpressionYeastPromoterGAPAvailable SinceJune 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
SuperNova-N1
Plasmid#131853PurposeExpresses SuperNova with C-terminal Myc-tag and N-terminal multiple cloning siteDepositorInsertSuperNova
TagsMyc tagExpressionMammalianPromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLTR-X-PURO
Plasmid#58246PurposeGATEWAY-compatible lentiviral conditional RNAi delivery vector; SFFV-driven expression of TetR and Puromycin selectionDepositorInsertPuro(R)
UseLentiviral and RNAi; Gateway destionation vectorTagsTetR-NLS-T2AExpressionMammalianPromoterSFFVAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only