We narrowed to 9,773 results for: ren
-
Plasmid#141522PurposeLentiviral vector for overexpressing the SMAD3 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-SRGAP3FBAR-EGFP
Plasmid#168506PurposeExpression of F-BAR domain (aa 1-492) of SRGAP3 with a C-terminal EGFP fusionDepositorAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNArodA
Plasmid#149656Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTJK512
Plasmid#121469PurposeCEN LEU2 CNB1DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG/MKRN1(1-280)
Plasmid#78752PurposeTo overexpress MKRN1(1-280) in Mammalian CellsDepositorAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -91
Plasmid#50923PurposeU6 driven sgRNA targeting Sox17 -91 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFbx15(-6/+134)-Luc
Plasmid#13404DepositorInsertUpstream region of mouse Fbx15 gene
UseLuciferaseExpressionMammalianMutationNoneAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMBS-843
Plasmid#217997PurposesmtHSP60 for protein targeting to mitochondrial matrixDepositorInsertsmtHSP60
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP-HDAC1 (pc2447)
Plasmid#240148PurposeExpression vector containing a fusion protein of eGFP and human HDAC1.DepositorAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA_N-human Bcl6
Plasmid#137851PurposeExpress Bcl6 in mammalian cellsDepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF2431
Plasmid#142422PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-SOX17
Plasmid#222925PurposePiggyBac transposon plasmid for doxycycline inducible expression of SOX17DepositorInsertSOX17 (SOX17 Human)
ExpressionMammalianAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRA2B-DuET
Plasmid#213178PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
R338G/V339P-LOXL2
Plasmid#200063PurposePoint mutant of hLOXL2 resistant to processing by Factor XaDepositorInserthuman lysyl oxidase like 2 (LOXL2 Human)
TagsHisExpressionMammalianMutationS300P mutationAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBOH-MHL_WDR54:1-334
Plasmid#210931PurposeInsect expression of full-length human WDR54. N-terminal 6X His tag with TEV cleavage.DepositorInsertWDR54:M1-V334 (WDR54 Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFBOH-MHL_CORO1C:1-474
Plasmid#210920PurposeInsect expression of full-length human CORO1C. N-terminal 6X His tag with TEV cleavage.DepositorInsertCORO1C:M1-A474 (CORO1C Human)
TagsMHHHHHHSSGRENLYFQGExpressionInsectMutationwild typePromoterPolyhedrinAvailable SinceMarch 20, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF2968
Plasmid#144444PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3489
Plasmid#144965PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3085
Plasmid#144561PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only