We narrowed to 13,228 results for: sequence
-
Plasmid#190511PurposeMammalian Expression of SPHKAP scFV. Derived from hybridoma L131/17.DepositorInsertSPHKAP (Mus musculus) recombinant scFV (Sphkap Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.3.1.ADRB2-NP
Plasmid#134376PurposeNanoluc complementation assay. Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of signal sequence and Flag epitope at N terminus of ADRB2.DepositorInsertADRB2-NP (ADRB2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-mCherry-DMDEx23-eGFP
Plasmid#211366PurposePiggybac transposon plasmid for a DMD exon 23 skipping reporter (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23-eGFP
ExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCAGAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pan-Synapsin scFv [L125/129]
Plasmid#182079PurposeMammalian Expression of pan-Synapsin scFv. Derived from hybridoma L125/129.DepositorInsertrecombinant mouse scFv targeting pan-Synapsin
TagsSortase, HisExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL6ST-bio-His
Plasmid#51806PurposeExpresses full-length Interleukin-6 receptor subunit beta precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertIL6ST (IL6R Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
NESRA-DEVD-BNLS
Plasmid#50849PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.DepositorInsertddRFP A and ddRFP B
TagsNES sequence LQKKLEELELDE placed after ddGFP A an…ExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pan-QKI scFv [N147/6]
Plasmid#211605PurposeMammalian Expression Plasmid of Pan-QKI scFv. Derived from hybridoma N147/6.DepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only