We narrowed to 6,905 results for: crispr cas9 plasmids
-
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralTagsExpressionMutationDeleted BbsI site within WPREPromoterAvailable sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-Hf-RfxCas13d-His
Plasmid#234480PurposePlasmid for bacterial expression and purification of High-fidelity RfxCas13d protein (human codon-optimized)DepositorInsertRfxCas13d
UseCRISPRTags6xHisExpressionBacterialMutationChanged four alanine to valine in positions 134, …PromoterAvailable sinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
P532_POU4F2-p2A-tdTomato-p2A-Thy1.2
Plasmid#239102PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of POU4F2 (aka BRN3B). This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertPOU4F2 (POU4F2 Human)
UseDonor plasmid for integration into the human geno…Tagsp2A-tdTomato-p2A-Thy1.2ExpressionMammalianMutationPromoterEndogenous POU4F2Available sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-EGFP-KASH
Plasmid#154374PurposeVector for Flp-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA
Plasmid#85756PurposeAll in one plasmid that expresses Csy4, S.pyogenes FokI-dCas9-NLS, and GFP. Also encodes for multiplexed gRNAs. Backbone derived from pSQT1601 (Addgene #53369).DepositorInsertsCsy4-T2A-SpRFN-P2A-GFP
gRNA
UseCRISPRTagsCsy4, Csy4 recognition sequence, FokI fusion via …ExpressionMammalianMutationD10A, H840APromoterCMV and U6Available sinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEditC
Plasmid#207532PurposePlasmid for cytidine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorTagsExpressionMutationPromoterAvailable sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-C-WPRE
Plasmid#176650PurposeExpresses C-terminus of PE2 in mammalian cellsDepositorInsertsC-terminus of PE2
Artificial SA
WPRE
bGH poly(A)
UseAAVTagsSV40 NLSExpressionMammalianMutationPromoterNoneAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-N
Plasmid#176649PurposeExpresses N-terminus of PE2 in mammalian cellsDepositorInsertsN-terminus of PE2
Artificial SD
UseAAVTagsSV40 NLSExpressionMammalianMutationPromoterCMV and NoneAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralTagsExpressionMutationPromoterEFS-NSAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN-CMV-Ca9-WPRE
Plasmid#87874PurposeTransfer plasmid for the production of lentiviral vectorsDepositorInsertspCas9
UseLentiviralTagsnlsExpressionMutationHuman codon-optimizedPromoterCMVAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralTagsExpressionMutationPromoterEFS-NSAvailable sinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only