-
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT40
Plasmid#223412PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT42
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZH82 pET28a-Rai1
Plasmid#231651PurposeBacterial expression vector expressing yeast S. cerevisiae rai1, no tagDepositorInsertrai1 (RAI1 Budding Yeast)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTBL3342 PB-PEmax-puro
Plasmid#226674PurposePiggyBac cargo vector encoding PEmax and puromycin resistance.DepositorInsertPEmax
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRTagsExpressionYeastMutationPromoterZ3Available sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJJB1559
Plasmid#218590PurposeExpress peroxisomal Idi1p, Erg20(F96W,N127W)p, and GESp to convert IPP to geraniol with cytosolic Erg20 homodimerDepositorInsertGES
UseTagsePTS1ExpressionYeastMutationErg20(F96W, N127W), Erg20-Erg20 synthetic homodim…PromoterAvailable sinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-28a (+)-Gal4-p53
Plasmid#171076PurposeExpresses Gal4-p53 fusion protein in bacteriaDepositorInsertGal4 DBD (NEWENTRY Budding Yeast)
UseTagsHis and p53(1-85)ExpressionBacterialMutationPromoterT7 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR91
Plasmid#203915Purposeempty BLINCAR plasmid for payload delivery, no payload, integrates at CRF1 locusDepositorInsertCRF1 plus flanking (CRF1 S. stipitis (yeast))
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR90
Plasmid#203914Purposeempty BLINCAR plasmid for payload delivery, no payload, integrates at GSC2 locusDepositorInsertGSC2 plus flanking (GSC2 S. stipitis (yeast))
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR89
Plasmid#203423Purposeempty BLINCAR plasmid for payload delivery, no payload, integrates at EGC3 locusDepositorInsertEGC3 plus flanking (EGC3 S. stipitis (yeast))
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
BS-ZJLEU-PTEF1-GFP
Plasmid#207018PurposeOver-expression of GFP under TEF1 promoter, use auxotrophic marker LEU2(Saccharomyces cerevisiae).DepositorInsertGFP
UseTagsExpressionYeastMutationPromoterpTEF1Available sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTPI1-Dsred-URA3
Plasmid#207017PurposeExpresses DsRed-Express 2 as a marker of cytosol, uses auxotrophic marker URA3(Saccharomyces cerevisiae).DepositorInsertDsRed-Express 2
UseTagsExpressionYeastMutationPromoterpTPI1Available sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only