We narrowed to 28,445 results for: tat
-
Plasmid#239341PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mScarlet-I in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
TagsmScarlet-IExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmStayGold(E138D)_I3
Plasmid#239338PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mStayGold(E138D) in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
TagsmStayGold(E138D)ExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IARS2-tb
Plasmid#232340PurposeExpresses human IARS2 with synonymous mutations (to prevent recognition by siRNA) in mammalian cellsDepositorInsertIARS2 (IARS2 Human)
ExpressionMammalianMutation5 synonymous mutations in the siRNA (ACUUGCAGUCAU…PromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p185-RV-CAG-dio-mScarlet-T2A
Plasmid#204739PurposeConditional expression of target gene with fluorescent reporter mScarletDepositorTypeEmpty backboneUseRetroviralPromoterCAGAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pISEre1reRNA
Plasmid#226821PurposeExpressing ISEre1 guide RNA targeting maeB site controled by PJ23119DepositorInsertISEre1 none target guide RNA
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-CFAPorig
Plasmid#221092PurposeFAP insert for C-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4003
Plasmid#215248PurposeModule for the constitutive expression of PIF6 and PhyB:VP16DepositorInsertPIF6-PhyB:VP16
UseSynthetic BiologyMutationV234L in PIF6- please see dep. sequence, BsaI and…Available SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS413-TEF1pr-NFAPorig
Plasmid#221091PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-NFAPorig
Plasmid#221086PurposeFAP insert for N-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-TEF1pr-CFAPorig
Plasmid#221087PurposeFAP insert for C-terminally tagging genes of interest (original FAP + 2xMYC tag)DepositorTypeEmpty backboneExpressionYeastAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m1
Plasmid#204463PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR A127N mutation.DepositorInsertsUseSynthetic BiologyMutationLasR A127N mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ103-rbs1-m2
Plasmid#204464PurposeThis is a biosensor with improved specificity to 3OC12-HSL, containing LasR L128C mutation.DepositorInsertsUseSynthetic BiologyMutationLasR L128C mutationPromoterIn an operon and PLasAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATG2A HRD
Plasmid#207540PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG2A locus in human cellsDepositorInsertHaloTag flanked by human ATG2A locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4653
Plasmid#215267PurposeTU for the constitutive expression of the flippase (FLP) recombinase with a nopaline synthase (Nos) promoterDepositorInsertpNos:FLP:tNos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4829
Plasmid#215275PurposeTU for the constitutive expression of the N. nambi NPGA gene under the P35S promoter and the TNOS terminatorDepositorInsertP35S:NPGA:TNOS
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM227
Plasmid#226650PurposeMSS-His6-UFD1LDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only