We narrowed to 10,433 results for: yeast
-
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (M)
Plasmid#182435PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96W-N127W) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (G)
Plasmid#182477PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96C) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-mRuby2
Plasmid#176550PurposeExpression of mRuby2 for auxotrophic selection in the absence of methionineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-mWasabi
Plasmid#176552PurposeExpression of mWasabi for auxotrophic selection in the absence of leucineDepositorInsertmWasabi
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-eCFP
Plasmid#176558PurposeExpression of eCFP for auxotrophic selection in the absence of methionineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-TagRFP657
Plasmid#176560PurposeExpression of TagRFP657 for auxotrophic selection in the absence of lysineDepositorInsertTagRFP657
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
ExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS22H-IRE
Plasmid#133905PurposePositive control when used in combination with pAWH-IRP. Expression of MS2BS-IRE site hybrid. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Ndi-1/myc-His
Plasmid#127503PurposeExpresses myc-tagged yeast Ndi-1 in mammalian cellsDepositorAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4.3
Plasmid#232743PurposeExpresses NADPH/NADP+ biosensor NAPstar4.3 in S. cerevisiae.DepositorInsertNAPstar4.3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstarC
Plasmid#232737PurposeExpresses control sensor NAPstarC in S. cerevisiae.DepositorInsertNAPstarC
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar3
Plasmid#232740PurposeExpresses NADPH/NADP+ biosensor NAPstar3 in S. cerevisiae.DepositorInsertNAPstar3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
DENV4 Rluc Reporter GND mutant Replicon
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424MutationThe conserved GDD in the NS5 polymerase gene muta…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar1
Plasmid#232738PurposeExpresses NADPH/NADP+ biosensor NAPstar1 in S. cerevisiae.DepositorInsertNAPstar1
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-HIV-1_PR
Plasmid#203493PurposeExpresses HIV-1 protease from a GALL promoter with a URA3 markerDepositorInsertHIV-1 protease
ExpressionYeastPromoterGALLAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0
Plasmid#165984PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-Lam
Plasmid#133899PurposeNegative control. Expression of Gal4BD-Lam hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCHKU34.1-2.2
Plasmid#115534PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5740
Plasmid#249327PurposeExpresses sgRNA targeting the fcy gene in S. cerevisiaeDepositorInsertsgRNA targeting fcy
ExpressionYeastMutationN/AAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only