We narrowed to 7,322 results for: mCherry
-
Plasmid#193082Purposeconstitutive expression of mCherry fused to human Gata2 with mutation C373R in mammalian cellsDepositorInsertmCh-GATA2-C373R
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-mCh-GATA2-R396Q
Plasmid#193083Purposeconstitutive expression of mCherry fused to human Gata2 with mutation R396Q in mammalian cellsDepositorInsertmCh-GATA2-R396Q
UseLentiviralExpressionMammalianPromoterSFFVAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_all-in-one_Bip gRNA1
Plasmid#183696PurposeExpresses gRNA targeting chinise hamster Bip (Hspa5) with CRISPRa components and mCherry, blasticidin selectiveDepositorInsertgRNA targeting chinese hamster Bip (Hspa5)
UseCRISPRAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYL237
Plasmid#173194PurposeCRISPR donor plasmid for making the RNA-binding mutant EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorInsertEZH2 RNA-binding mutant
UseCRISPRExpressionMammalianAvailable sinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGF172
Plasmid#96998Purposeish1 mCherry insertion cassette with ura4+ geneDepositorInsertish1 (ish1 Fission Yeast)
TagsGST and mCherryExpressionBacterialMutationish1 C-terminal domain fused with mCherry + ura4(…PromoterN/AAvailable sinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16 (B695)
Plasmid#92031PurposeExpresses CRY2 (full length, intact NLS) fusion with Gal4DBD(aa1-147) fused to VP16AD (truncated), downstream of mCherry-IRES.DepositorAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB-TAC-WTSI
Plasmid#80486PurposepiggyBac transposon for dox-inducible expression of the WTSI polycistronic reprogramming cassette (with mCherry)DepositorInsertWTSI
UsePiggybac transposonExpressionMammalianPromotertetOAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pS12<ActB.mus_2A-mCh_KI-HMEJ
Plasmid#207407PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]DepositorAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgNT-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211689PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgNT-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-1_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211690PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-1 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF826-sgCIDE-2_U6-sgRNA-EFS-Cas9-P2A-mCherry2
Plasmid#211691PurposeU6-sgRNA-EFS-Cas9-P2A-mCherry2DepositorInsertSpyCas9 and sgCIDE-2 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHBS1397 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 W385G]
Plasmid#118812PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1400 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 G295F]
Plasmid#118814PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1393 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 deltaRRM]
Plasmid#118805PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationDeletion of RRM in full-length TDP43Available sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1394 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 deltaCTD]
Plasmid#118806PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationDeletion of CTD in full-length TDP43Available sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1331 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 W385G]
Plasmid#107854PurposeTo test the effect of sequence on TDP43 splicing activityDepositorAvailable sinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only