We narrowed to 13,796 results for: CAN
-
Plasmid#137779PurposeVisualization of GRK2DepositorInsertBovine GRK2[D110A K220R] (GRK2 Bovine)
ExpressionMammalianMutationD110A K220RPromoterCMVAvailable SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
HsGRK6[L66A E514A]-sYFP2
Plasmid#137781PurposeVisualization of GRK6DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
mei-S332 5.6Kb genomic DNA in Casper4
Plasmid#112984PurposeP element vector for transposon insertion of mei-S332 5.6Kb genomic DNA into Drosophila genomeDepositorAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
719-2µ-minHIS3
Plasmid#40610DepositorInsertHIS3 (HIS3 Budding Yeast, Synthetic)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mTurquoise2
Plasmid#112953PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmTurquoise2ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
CytERM-mKOkappa
Plasmid#98832PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
TagsmKOkappaExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CytERM_3xmTurquoise2
Plasmid#112958PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
Tags3x mTurquoise2ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGLU_103
Plasmid#225785PurposeThis is the promoter region taken from upstream of Tn5 transposase in pBAM1. It can be considered the "default" promoter to use.DepositorInsertPtn5_[Tn5]
UseSynthetic BiologyMutationN/AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGLU_85
Plasmid#225800PurposeThis is the promoter region taken from upstream of Himar transposase in pMarC9-Kan. It can be considered the "default" promoter to use.DepositorInsertPmarC9_[Himar]
UseSynthetic BiologyMutationN/AAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/o35S[]:MCS:NosT
Plasmid#212163PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (original 35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/t35S[]:MCS:NosT
Plasmid#212164PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (truncated35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mScarlet-I
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-EF1a-CreERT2-3Xflag-T2A-eBFP2
Plasmid#170186PurposeThis Cre-ERT2 expressing construct can be used to inducibly recombine loxp sites. It can be used with poly-loxP containing plasmids to generate timestamp barcodes useful for linage tracingDepositorInsertCreERT2-T2A-eBFP2
UseLentiviralPromoterEF1 alphaAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-E1799K
Plasmid#69009Purposeactivating MTOR mutationDepositorInsertMTOR-E1799K (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Glutamate 1799 to LysineAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-F1888L
Plasmid#69010Purposeactivating MTOR mutationDepositorInsertMTOR-F1888L (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Phenylalanine 1888 to LeucineAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
sAB-K29
Plasmid#204735Purposesynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitinDepositorInsertsynthetic antigen-binding fragment that can specifically recognize K29-linked polyubiquitin
Available SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-S2215Y
Plasmid#69013Purposeactivating MTOR mutationDepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
HsB2AR-mCherry
Plasmid#137785PurposeVisualization of the Beta-2-adrenergic receptorDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only