We narrowed to 6,928 results for: tac
-
Plasmid#162551PurposesgRNA targeting ApobDepositorAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only
-
TET-pLKO.1 PURO shGDF11 #1
Plasmid#83083PurposeLentiviral shRNA vector for inducible knockdown of human GDF11 (cross reacts with mouse Gdf11)DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001145502)
Plasmid#76851Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAF1 gRNA (BRDN0001145163)
Plasmid#77871Purpose3rd generation lentiviral gRNA plasmid targeting human TAF1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75242PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1E gRNA (BRDN0001147318)
Plasmid#77977Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1EDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001148854)
Plasmid#76652Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_1k)-PGKpuro2ABFP-W
Plasmid#208416PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
hnRNPA1_allW_D262V-FLAG-IRES-eGFP
Plasmid#234621PurposeMammalian expression of full-length hnRNPA1 D262V with all aromatic amino acids in the C-terminal LCD mutated to W keeping the hexapeptide fibril core (SYNDFG) and the PY-NLS intact.DepositorInserthnRNPA1 allW D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, all aromatic amino …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(12))-PGKpuroBFP-W
Plasmid#208569PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only