We narrowed to 16,155 results for: LEA
-
Plasmid#192214PurposeConsensus I-C CRISPR Leader and a CRISPR locus with two consensus I-C repeats, for integration assays.DepositorInsertConsensus I-C Leader and Consensus I-C Locus DNA
ExpressionBacterialAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCon-IIAl_Con-IIAr
Plasmid#192215PurposeConsensus II-A CRISPR Leader and a CRISPR locus with two consensus II-A repeats, for integration assays.DepositorInsertConsensus II-A Leader and Consensus II-A Locus DNA
ExpressionBacterialAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX1-IFl_Con-IFr
Plasmid#192216PurposeMutant I-F CRISPR Leader and a CRISPR locus with two consensus I-F repeats, for integration assays.DepositorInsertI-F leader and I-F repeat construct not studied further in this paper (X1)
ExpressionBacterialAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX2-IFl_Con-IFr
Plasmid#192217PurposeMutant I-F CRISPR Leader and a CRISPR locus with two consensus I-F repeats, for integration assays.DepositorInsertI-F leader and I-F repeat construct not studied further in this paper (X2)
ExpressionBacterialAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NRCH-CGBE1
Plasmid#198557PurposeExpresses human codon-optimized SpCas9-NRCH-CGBE1 and blasticidin resistance: EFS promoter-SpCas9-NRCH-CGBE1-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-CGBE1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.1
Plasmid#188065PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.1)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 4 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.7
Plasmid#188066PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.7)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 3 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRoC30_Th3.10
Plasmid#188067PurposeFuncLib-designed high-redox potential laccase from Trametes hirsuta (Th3.10)DepositorInsertFuncLib-designed high-redox potential laccase from Trametes hirsuta
TagsS. cerevisiae evolved α-factor prepro-leader sign…ExpressionYeastMutation20 PROSS + 3 FuncLib mutations, described in publ…Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-mmPCSK9
Plasmid#205634PurposereRNA guide targeting Mus Musculus PCSK9DepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein with Nluc tagged E2
Plasmid#215699PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-NLucE2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-NLucE2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-ArgiNLS-miRFP670
Plasmid#220600PurposeConstitutive expression of a single-cell discriminating version of miRFP670 fluorescent protein.DepositorInsertmiRFP670
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT
Plasmid#214041PurposeBacterial expression plasmid for SAVED-CHAT from Haliangium ochraceumDepositorInsertSAVED-CHAT
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
DRD2-V2tail-TevN-BLITz-TetR-FKBP
Plasmid#210514Purposeexpresses DRD2-V2tail-TevN-BLITz-TetR-FKBP component in mammalian cellsDepositorInsertDRD2-V2tail-TevN-BLITz-TetR-FKBP
TagsHA signal FALGExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
WT_IFL_G1A-T2A-A28C_R
Plasmid#200185PurposeWT PA14 I-F Leader and G1A-T2A-A28C RepeatDepositorInsertWildtype I-F Leader and a mutant I-F Locus (G1A-T2A-A28C)
ExpressionBacterialMutationG1A-T2A-A28C in the I-F repeatAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D197, 199N IRES GFP
Plasmid#195701PurposeLentiviral plasmid encoding SYT9 with D197, 199N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW SYT9 D330, 332N IRES GFP
Plasmid#195702PurposeLentiviral plasmid encoding SYT9 with D330, 332N mutations followed by an internal ribosomal entry site followed by EGFP under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
PET-HypaR-SpCas9-NLS-6xHis
Plasmid#207387PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertHypaR-SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationR661A, N692A, M694A, Q695A, H698APromoterT7Available SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only