We narrowed to 18,004 results for: URE
-
Plasmid#58878PurposeMESA split-TEV protease chain with Rapamycin FKBP ectodomain, 2 aa scaffold, 6 aa linker domain, N-terminal TEV proteaseDepositorInsertMESA split protease chain with FKBP rapamycin-binding ectodomain and N terminal fragment of TEV protease
UseAAVExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-TYR
Plasmid#32780DepositorAvailable SinceOct. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-FEN1hWT
Plasmid#35027DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNP568
Plasmid#222725PurposepNP555 - IS621 RE-LE TBL-WT, DBL-WT bRNA in cisDepositorInsertIS621 bridge RNA
TagssfGFPExpressionBacterialAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(1)_Tornado-Corn
Plasmid#159487PurposeTests for the impact of 1 uracil in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(1)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-iCAM-1
Plasmid#205186PurposeThis vector encodes of a synCAM (iCAM1) and GFPDepositorInsertsynCAM iCAM1 and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcold-6xHis-HRV3Csite-HsPACT
Plasmid#41097DepositorAvailable SinceNov. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEBFP2-Nuc
Plasmid#14893PurposeMammalian expression of EBFP2 blue fluorescent protein with NLSDepositorInsertpEBFP2-Nuc
TagsNLSExpressionMammalianMutationReplace EYFP of the vector pEYFP-Nuc from Clontec…Available SinceMay 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pHis-hTG2
Plasmid#100719PurposeExpression of human transglutaminase 2 in E.coliDepositorInsertTGM2 (TGM2 Human)
TagsHisExpressionBacterialMutationsilent mutation Arg580 (AGG--CGT) to enhance expr…PromoterT7Available SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEP0001_pIVTRup(BsmBI)_EGFP
Plasmid#242543PurposeIVTDepositorInsertEGFP2
UseOtherAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
mNeongreen-PXN
Plasmid#129604PurposeIn vivo visualization of focal adhesions (can be used for colocalization studies)DepositorInsertPaxillin
ExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET32-sLatherin
Plasmid#61685Purposebacterial expression of the horse sweat/saliva protein Latherin as a His-tagged thioredoxin fusionDepositorInsertLatherin (LATH horse)
TagsHIS and Trx-Tag thioredoxin proteinExpressionBacterialMutationCodon optimized for E.coliPromoterT7Available SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
nls-transposase-nls-pA in pT3TS-Dest
Plasmid#140873PurposeVector for in vitro transcription of Tol2 nls-transposase-nls for zebrafish transgenesis using T3.DepositorInsertnls-transposase-nls (Tol2)
Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Mito-mRFP
Plasmid#169001PurposeExpress Mito (Su9)-mRFP in zebrafishDepositorInsertMito (Su9)-mRFP (encoding a mitochondrial matrix targeting sequence of subunit 9 of the V0 ATPase Su9 of N. crassa)
UseUnspecifiedTagsmRFPAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHS1623
Plasmid#239833PurposeWT OrufIscB E. coli expression for recombinant purificationDepositorInsertOrufIscB
Tags14xHis-TwinStrep-bdSUMOExpressionBacterialPromoterT7Available SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only