We narrowed to 7,527 results for: lenti crispr
-
Plasmid#194882PurposeExpression of dominant negative MEK1DepositorAvailable SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pHR-UCOE-SFFV-SID4x-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188901PurposedCas9 with an N-term Sid4x fusion, a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertSID-dCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, P2A-GF…PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUGW ORANGE Gria1-GFP KI _ mCherry-KASH
Plasmid#131507PurposeEndogenous tagging of GluA1: C-terminal (amino acid position: STOP codon)DepositorUseLentiviralExpressionMammalianPromoterhUBCAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMB4
Plasmid#122246PurposeLentivirus delivery for stable expression of As crRNA, has AsDR; Cloning vector for expression of AsCpf1 crRNA. It contains BsmBI site for cloning.DepositorTypeEmpty backboneUseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMB30
Plasmid#122247PurposeLentivirus delivery for stable expression of Lb crRNA, has LbDR; Cloning vector for expression of LbCas12a crRNA. It contains BsmBI site for cloning.DepositorTypeEmpty backboneUseLentiviralAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_NFATC2-sgRNA
Plasmid#188704PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human NFATC2DepositorInsertNFATC2 sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV-PE_CO-Mini
Plasmid#190338PurposeLentiviral vector expressing PE_CO-Mini (Prime editor with codon-optimized and truncated Reverse transcriptase)DepositorInsertPE_CO-Mini, ngRNA and pegRNA for HEK3 CTTins
UseLentiviralAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Syn1-mCherry
Plasmid#222967PurposeMake lentivirus to express mCherry in syn1 expressing cellsDepositorInsertmCherry
UseLentiviralPromotersynapsin IAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'GAC)
Plasmid#170127PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'GAC)
Plasmid#170129PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-APOBEC1-YTHmut
Plasmid#178950PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTHmut in mammalian cellsDepositorInsertAPOBEC1-YTHmut-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 sgRipk4 v3
Plasmid#158048Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Ripk4. NO Cas9DepositorInsertRipk4 sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-CreERT2 sgAdam10 v3
Plasmid#158047Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Adam10. NO Cas9DepositorInsertAdam10 sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCCL-PGK-SPdCas9-BFP-DNMT1
Plasmid#66818PurposedCas9 fused to BFP and the human DNMT1 catalytic domainDepositorInsertdCas9-BFP-DNMT1, catalytic domain (DNMT1 )
ExpressionMammalianAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only