We narrowed to 5,049 results for: Mos
-
Plasmid#14459DepositorInsertBrd4 CTD (BRD4 Human)
UseRetroviralTagsSV40 NLSExpressionMammalianMutationamino acids 1047-1362 of Brd4 (the CTD). Function…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-CenpB 1-166-dCEN- Incenp-GFP
Plasmid#108484Purposeinducible expression of vsv-CenpB-1-166-dCEN-INCENP-EGFPDepositorInsertCenpB-dCEN-INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationCEN box replaced by CenpB 1-166PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Frt-V5-hspB2
Plasmid#63103PurposeExpression of HSPB2 (small HSP) tagged with V5 in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RASEFIR-HA
Plasmid#46863Purposeexpresses mouse IL-17RA with SEFIR deletionDepositorInsertIL-17RA-delta-SEFIR (Il17ra Mouse)
Tags3x HAExpressionMammalianMutationDeletion of SEFIR domain (AA 394-485)PromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
HMGN1_pcDNA6.2/EmGFP-Bsd
Plasmid#176943PurposeMammalian expression vector encoding HMGN1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB2
Plasmid#63093PurposeExpression of HSPB2 (small HSP) in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-AuroraB L154G/H250Y
Plasmid#108492Purposeexpression of EGFP-AuroraB Analog sensitive (L154G/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsEGFPExpressionMammalianMutationAnalog sensitive L154G/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.218.CAR-2G
Plasmid#194459PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only