We narrowed to 13,600 results for: sequence
-
Plasmid#71973PurposeExpresses the extracellular region of the Neuropilin 2, isoform 2 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Plxnb1(S)-AP-His
Plasmid#72001PurposeExpresses the N-terminal extracellular region of the PlexinB1 protein following proteolytic cleavage (ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.h-AP-His
Plasmid#71991PurposeExpresses the extracellular region of the Netrin G1, isoform h protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.e-AP-His
Plasmid#71988PurposeExpresses the extracellular region of the Netrin G1, isoform e protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.f-AP-His
Plasmid#71968PurposeExpresses the extracellular region of the Neogenin 1, isoform f protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.6-AP-His
Plasmid#71977PurposeExpresses the extracellular region of the Neuropilin 2, isoform 6 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lrrc4c-AP-His
Plasmid#71959PurposeExpresses the extracellular region of the LRRC4C protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.g-AP-His
Plasmid#71969PurposeExpresses the extracellular region of the Neogenin 1, isoform g protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(S)-AP-His
Plasmid#72014PurposeExpresses the Sema3B protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.d-AP-His
Plasmid#71966PurposeExpresses the extracellular region of the Neogenin 1, isoform d protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.5-AP-His
Plasmid#71976PurposeExpresses the extracellular region of the Neuropilin 2, isoform 5 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nrp2.4-AP-His
Plasmid#71975PurposeExpresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntng1.j-AP-His
Plasmid#71993PurposeExpresses the extracellular region of the Netrin G1, isoform j protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K2S
Plasmid#62980PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 446-911 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K3S
Plasmid#62981PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 911-1406 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K4S
Plasmid#62982PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 1406-1781 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K6S
Plasmid#62983PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 2086-2639 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pScalps_puro_mIL-2Rα ST
Plasmid#59919PurposeExpresses mouse interleukin-2 receptor alpha chain mutatedDepositorInsertinterleukin 2 receptor alpha (Il2ra Mouse)
UseLentiviralMutationchanged sequence of the intracellular (C-terminal…Available SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCR4-*mRFP
Plasmid#47118PurposeCan be used to make an RNA probe for whole-mount in situ hybridization, for in-frame fusion proteins or as a subcloning step for mRFP. Note that the coding sequence for mRFP lacks the start codon.DepositorInsert*mRFP
ExpressionBacterialMutationNo start codonPromoterLacAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #2
Plasmid#136583PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailabilityAcademic Institutions and Nonprofits only -
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC7A11
Plasmid#132244PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC7A11 (SLC7A11 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA 3.1 SIRT1-FL
Plasmid#105670PurposeMammalian expression construct of mouse SIRT1 full length isoformDepositorInsertSIRT1 (Sirt1 Mouse)
ExpressionMammalianMutationSynonymous base changes not affecting the protein…PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC35D3
Plasmid#132110PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35D3 (SLC35D3 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-SOD2-2A-Catalase-WPRE
Plasmid#67635PurposeAAV vector expressing both SOD2 and mitochondrial targeted CatalaseDepositorUseAAVMutationDeleted the Peroxisome Targeting Signal from Cata…PromoterCMVAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-InPGrp-Kras
Plasmid#236001PurposeGenetically encoded FRET-based phosphoinositide sensor for monitoring PI(3,4,5)P3. Targeted to plasma membrane.DepositorInsertInPGrp-Kras (Cyth3 Synthetic, Rat)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-InPTapp-Kras
Plasmid#235999PurposeGenetically encoded FRET-based phosphoinositide sensor for monitoring PI(3,4)P2. Targeted to plasma membrane.DepositorInsertInPTapp-Kras (PLEKHA1 Synthetic, Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only