We narrowed to 7,709 results for: CCH
-
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pROS13-Tps2/Gsy1
Plasmid#196613PurposeEncoding guide RNAs for the knock out of TPS2 and GSY1 genesDepositorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES
Plasmid#182433PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20 (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertsVP2C-FPPS
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (M)
Plasmid#182435PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96W-N127W) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed VLP NES (G)
Plasmid#182477PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter), VP2C-ERG20(F96C) (GAL10 promoter), and VP2C-AcNES1 (GAL7 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)
deltaVP1
VP2C-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1, GAL10, and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free PcPTS
Plasmid#182483PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and patchoulol synthase from Pogostemon cablin (PcPTS; GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS
PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES (AG4TGGA)2
Plasmid#182488PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence (AG4TGGA)2 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free (PT)4P
Plasmid#182490PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence PTPTPTPTP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGST2-GST-TEV-OPTN S177D S473D
Plasmid#187827PurposePlasmid for the expression and purification of GST-TEV-OPTN S177D S473D. Internal Ref: SMC1588DepositorAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D
Plasmid#115193PurposeLentiviral transduction and expression of PDHA2S291D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S293D
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b p97-Strep-His E314Amb
Plasmid#169021PurposeExpresses p97-Strep-His E314Amb (incorporates noncanonical amino acid at position 314 via amber suppression) in bacteriaDepositorInsertp97
TagsHis and SBPExpressionBacterialMutationE314TAGPromoterT7Available SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-MIOX
Plasmid#166680PurposeYeast integrative plasmid for expressing deltaVP1 (GAL1 promoter) and mouse myo-inositol oxygenase tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-MIOX
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFP
Plasmid#166674PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFP
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] K683E, H685E, K686E-Ss(424)
Plasmid#166855PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in K683E, H685E, K686E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationK683E, H685E, K686EPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)
Plasmid#166854PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationF641E, I645EPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)
Plasmid#166853PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
Tags6xHisExpressionYeastMutationF641G, I645GPromoterpCuAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only