We narrowed to 27,366 results for: c-myc
-
Plasmid#124572PurposeExpresses full-length TaNAM-A1 with an N-terminal 10x Myc tag under the 35s promoter.DepositorInsertTaNAM-A1
Tags10xMycExpressionPlantPromoter35sAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ERAP1-rs27895(C)
Plasmid#206142PurposeExpresses the rs27895-C allele of ERAP1, myc-tagged.DepositorInsertERAP1 (ERAP1 Human)
Available sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-CaMKIIα-igκ-mEGFP-TM
Plasmid#259745PurposeAn AAV expression vector designed to target the SynTrogo ligand specifically to excitatory neurons in vivo under the control of the CaMKIIα promoter.DepositorAvailable sinceSept. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-igκ-αGFP-TM-FusionRed
Plasmid#259744PurposeA mammalian expression vector designed to express the FusionRed-tagged SynTrogo receptor in vitro under the control of the CMV promoter.DepositorInsertigκ-αGFP-TM-FusionRed (IGK Human, Synthetic)
TagsFusionRed, Myc, PDGFR TM, and vhhGFPExpressionMammalianPromoterCMVAvailable sinceSept. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-LYN
Plasmid#259385PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-EPHB1
Plasmid#259380PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-EPHA4
Plasmid#259386PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-FES
Plasmid#259382PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJD460
Plasmid#246006PurposeA plasmid for Massively Parrallel Reporter Assays of 5'UTR function. It includes a CMV promoter, ITRs for AAV packaging, cloning sites. This does not include elements or reporters.DepositorTypeEmpty backboneUseAAV and Cre/LoxTagsN-terminal Myc Tag on a TdTomato (which has an in…ExpressionMammalianAvailable sinceAug. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJD486
Plasmid#246005PurposeA plasmid for Massively Parallel Reporter Assays of 5'UTR function. It includes a CMV promoter, ITRs for AAV packaging, cloning sites. This is derived from pJD460 (Addgene #246006) by adding reporter.DepositorTypeEmpty backboneUseAAV and Cre/LoxTagsN-terminal Myc Tag on a TdTomato (which has an in…ExpressionMammalianPromotercmvAvailable sinceAug. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
kVh-FGFR3
Plasmid#259383PurposeKinase co-expression for phosphorylation of substrateDepositorAvailable sinceAug. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-igκ-mEGFP-TM
Plasmid#259743PurposeA mammalian expression vector designed to express the mEGFP-tagged SynTrogo ligand in vitro under the control of the CMV promoter.DepositorInsertigk-mEGFP-PDGFR TM (IGK Human, Synthetic)
TagsEGFP, Myc, and PDGFR TMExpressionMammalianPromoterCMVAvailable sinceAug. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
420_pETcon_SARS2_LP.8.1.1
Plasmid#254411PurposeYeast surface display of the SARS-CoV-2 LP.8.1.1 variant RBD.DepositorInsertSARS-CoV-2 LP.8.1.1 RBD
TagsHA and c-MycExpressionYeastAvailable sinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
336_pETcon_SARS2_KP.3.1
Plasmid#254410PurposeYeast surface display of the SARS-CoV-2 KP.3.1 variant RBD.DepositorInsertSARS-CoV-2 KP.3.1 RBD
TagsHA and c-MycExpressionYeastAvailable sinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.3 N-HA KTUB
Plasmid#246174PurposeUsed for transfection of cells for expression N-HA KTUBDepositorInsertKTUB
TagsMycExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRS316 Gal1p1 IpgA
Plasmid#242952PurposeExpression of IpgA in yeast cellsDepositorInsertIpgA (IcsB Chaperone)
TagsMycExpressionYeastAvailable sinceMarch 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7-GNAI1
Plasmid#248653PurposeYeast 2-hybrid vector encoding human heterotrimeric G protein GNAI1 fused to the GAL4 DNA binding domain.DepositorAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7-GNAO1
Plasmid#248654PurposeYeast 2-hybrid vector encoding human heterotrimeric G protein GNAO1 fused to the GAL4 DNA binding domain.DepositorAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only