We narrowed to 10,769 results for: yeast
-
Plasmid#233528PurposeExpresses Sr62NLRa in yeastDepositorInsertSr62NLRa
TagsGAL4 AD, HA tagExpressionYeastPromoterADH1Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG-GW1
Plasmid#203163PurposeYeast expression vector; To express proteins under control of TDH3 promoter and terminator using leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3036(XI-1 MarkerFree)
Plasmid#73274PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-1 (Chr XI: 67491..68573)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3037(XI-5 MarkerFree)
Plasmid#73277PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-5 (Chr XI: 11779..118967)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104-KanMX-sgRNAv2
Plasmid#254712PurposeYeast CRISPR-Cas9 backbone with sgRNA cassette for rapid PCR-based guide insertion; KanMX/G418 selection in S. cerevisiae, Amp/Kan propagation in E. coli.DepositorAvailable sinceAug. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
420_pETcon_SARS2_LP.8.1.1
Plasmid#254411PurposeYeast surface display of the SARS-CoV-2 LP.8.1.1 variant RBD.DepositorInsertSARS-CoV-2 LP.8.1.1 RBD
TagsHA and c-MycExpressionYeastAvailable sinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
336_pETcon_SARS2_KP.3.1
Plasmid#254410PurposeYeast surface display of the SARS-CoV-2 KP.3.1 variant RBD.DepositorInsertSARS-CoV-2 KP.3.1 RBD
TagsHA and c-MycExpressionYeastAvailable sinceJuly 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY40
Plasmid#249718PurposepGY40 is a CRISPR cytosine base editing vector with nCas9 and sgRNA cassette, enabling targeted C-to-T conversions at NGG PAM sites in filamentous fungi.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable sinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY49
Plasmid#249719PurposepGY49 is a CRISPR adenine base editing vector with nCas9 and sgRNA cassette, enabling targeted A-to-G conversions at NGG PAM sites in filamentous fungi.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable sinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA143
Plasmid#248147Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen2' mutationsDepositorInsertluxR (gen3 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: F51 (TTC→TTT), G88E. LuxR: K53E, N86Y, I…PromoterpPGK1Available sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA141
Plasmid#248146Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen2' mutationsDepositorInsertluxR (gen2 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: G8V. NLS: K120N. LuxR: N86K, K104E, M135VPromoterpPGK1Available sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available sinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7
Plasmid#248655PurposeEmpty vector for generating yeast 2-hybrid GAL4 DNA binding domain fusion constructs by Gateway cloning. It may also be used as an empty vector experimental control.DepositorTypeEmpty backboneUseYeast 2-hybridTagsGAL4 binding domain, MycExpressionYeastAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GADT7
Plasmid#248657PurposeEmpty vector for generating yeast 2-hybrid GAL4 activation domain fusion constructs by Gateway cloning. It may also be used as an empty vector experimental control.DepositorTypeEmpty backboneUseYeast 2-hybridTagsGAL4 activation domain, HAExpressionYeastAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
Aga2p-TEVcs-LacAnc100-myc_pCTCON2
Plasmid#245298Purposeexpresses LaccID on the yeast surfaceDepositorInsertAga2p-LacAnc100
ExpressionYeastAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only