We narrowed to 11,237 results for: aga
-
Plasmid#68818PurposeFlag tagged mammalian expression of GC domainDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_1
Plasmid#155065PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR3-FLAG-Gephyrin G
Plasmid#68817PurposeGeph G domain expression in mamalian cellsDepositorAvailable SinceAug. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-PA-mCherry
Plasmid#247339PurposeExpresses photoactivatable H2B-Cherry under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-H2B-PAmCherry-FRT
Plasmid#247337PurposeExpresses photoactivatable H2B-Cherry under EF1 promoter and can be integrated into FRT siteDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR Gal4-UAS_3XFlag_4D5-5_CAR-mCherry_pGK_BFP
Plasmid#247572PurposeGAL4/UAS expression of a CAR against HER2 and mCherry with constitutive BFPDepositorInsertGAL4/UAS expression of a CAR against HER2 - mCherry and BFP constitutive
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-CAPRIN1-ts1
Plasmid#174229PurposeCAPRIN1 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(VENTX_5-5)-PGKpuroBFP-W
Plasmid#211993PurposeExpress gRNA against VENTX with puro and BFPDepositorInsertsgRNA targeting VENTX (VENTX Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFDPS #2
Plasmid#198760Purposeconditional knockdown of FDPSDepositorInsertshFDPS #2 (FDPS Human)
ExpressionMammalianAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_gRNA_H19-DMR-1
Plasmid#159929PurposeSpecific gRNA against mouse H19-DMR cloned in the pX330 backbone (Addgene Number 42230). Deletion of H19-DMR in mouse ESC.DepositorInsertgRNA mouse H19-DMR (H19-icr Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6, CBhAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_PDPR_exon_deletion_4
Plasmid#155068PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of PDPR exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLK2 gRNA (BRDN0001147939)
Plasmid#75617Purpose3rd generation lentiviral gRNA plasmid targeting human TLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-mCherry-P2A-HA-KORD
Plasmid#204359PurposeAAV vector for coexpression of miniDq and KORD under the control of human synapsin promoterDepositorInsertminiDq-mCherry-P2A-HA-KORD
UseAAVTagsHA (for KORD) and mCherry (for miniDq)MutationFor miniDq, the third intracellular loop (ICL3) o…PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP1-N1-Dsup
Plasmid#90020PurposeTo express GFP-tagged Dsup in mammalian cells transientlyDepositorInsertDsup
TagsAcGFP1ExpressionMammalianPromoterCMVAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgCTL
Plasmid#234771PurposeNon Targeting ControlDepositorInsertNon Targeting Control sgRNA
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only