We narrowed to 27,366 results for: c-myc
-
Plasmid#208035PurposeEnables inducible expression of C-terminal Split-TurboID-fused SUMO1nc, to perform SUMO-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
rgef-1p::NmBirA
Plasmid#79971Purposeencodes E.coli biotin-ligase under neuronal promotor for C.elegansDepositorInsertBirA
TagsNLS::mycExpressionWormPromoterrgefAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG106 Lyn11-FAST
Plasmid#130721PurposeExpresses FAST (also called YFAST) fused to Lyn11 sequence in mammalian cellsDepositorInsertlyn11-FAST
Tagsmyc-tagExpressionMammalianPromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pOPINB-HOIL-1 helix-RBR (233–510)
Plasmid#193859PurposeExpression of human His-tagged HOIL-1 (RBCK1) helix-RBR (aa 233–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationResidues 233–510, codon optimised for expression …PromoterT7Available sinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-C145A-Q306A
Plasmid#177335Purposebacterial expression of inactive SARS-CoV-2 3C-like-C145A proteinaseDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available sinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
-
Lenti-A3An-LRG2.1T
Plasmid#253343PurposeExpresses the N-terminal fragment of a rapamycin-inducible split A3A cytosine base editor together with an sgRNA expression cassette for in vivo base editingDepositorInsertA3An
UseCRISPR and LentiviralTagsmyc-A3An-FRBPromoterEFSAvailable sinceApril 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
ER-CanlonicSF
Plasmid#178343PurposeTo explore endoplasmic reticulum lactate dynamicsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertER-CanlonicSF
TagsER Retention Signal, ER Signal Exon 1, and ER Sig…ExpressionMammalianPromoterCMVAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSCRET2(#323)
Plasmid#184058Purposecyclofen-inducible CRE activation via mammalian cell transfection or mRNA synthesisDepositorInsert6myc-CRE-ERT2
UseSynthetic BiologyTags6xMycExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available sinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTV001
Plasmid#130265PurposeEatA expression plasmid containing 8His encoding region in permissive site of eatA geneDepositorInserteatA::His8
Tagspolyhistidine (internal)ExpressionBacterialMutation8His polyhistidine encoding region and XhoI site …PromoteraraBADAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pK3FS-PYK1
Plasmid#85777PurposeN-ICE plasmid pK3FS-PYK1DepositorInsertloxP-KanMX-loxP-PYK1p-3FLAG
UseCre/LoxExpressionYeastAvailable sinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYSD054
Plasmid#252967PurposeEncodes S. cerevisiae MYC Tag-Aga2-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable sinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD058
Plasmid#252971PurposeEncodes S. cerevisiae MYC Tag-Aga2-linker as a Type 3a part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable sinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_D262V-FLAG-IRES-eGFP
Plasmid#234620PurposeMammalian expression of full-length hnRNPA1 D262V with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthnRNPA1 D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, C-terminal FLAG tag…PromoterCMVAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMH-HA/Joseph2-Multitagged Plasmid
Plasmid#226726PurposeValidates the expression and detection of epitope-tagged proteins of interest in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpMH-HA/Joseph2
TagsHA, Myc, GFP, Flag, V5, HisExpressionMammalianPromoterCMVAvailable sinceOct. 24, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV6-Entry IL36RN S113L
Plasmid#58321Purposeentry vector for human IL36RN S113L mutantDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIL36RN (IL36RN Human)
UseGateway CloningTagsmyc-DDKMutationS113L: c.338C>T, p.Ser113LeuPromoterCMVAvailable sinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV6-Entry IL36RN R102W
Plasmid#58323Purposeentry vector for human IL36RN R102W mutantDepositorInsertIL36RN (IL36RN Human)
UseGateway CloningTagsmyc-DDKMutationR102W: c.304C>T, p.Arg102TrpPromoterCMVAvailable sinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -