We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#244025PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-AtEXO1B-N
Plasmid#244024PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of LbCas12a, connected by a flexible XTEN linker, without promoterDepositorInsertCas12a
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD1)-hSyn-mCherry
Plasmid#231400PurposeKnockdown of DRD1 across rodent speciesDepositorInsertsgRNA(DRD1.2)
UseAAV and CRISPRExpressionMammalianPromoteru6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(deltaD2)-hSyn-mCherry
Plasmid#231401PurposeKnockdown of DRD2 across rodent speciesDepositorInsertsgRNA(DRD2.1)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-u6-gRNA(CTRL)-hSyn-mCherry
Plasmid#231405PurposeCTRL knockdown gRNADepositorInsertsgRNA(CTRL)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonorTp-fugfp
Plasmid#211790PurposepDonorTp with addition of fugfp gene from pUS252 outside of the FRT sitesDepositorInsertfuGFP
Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-Vamp2-Tag-HA
Plasmid#218188PurposeTo tag endogenous mouse VAMP2 with HADepositorInsertsgRNA (Vamp2 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcna2
Plasmid#192796PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcna2DepositorInsertsgKcna2
UseAAV and CRISPRPromoterU6Available SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcna6
Plasmid#192797PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcna6DepositorInsertsgKcna6
UseAAV and CRISPRPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
phU6 NFATC2
Plasmid#188708PurposesgRNA plasmid encoding hU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmU6 NFATC2
Plasmid#188709PurposesgRNA plasmid encoding mU6 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
p7SK NFATC2
Plasmid#188710PurposesgRNA plasmid encoding 7SK promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
phH1 NFATC2
Plasmid#188711PurposesgRNA plasmid encoding hH1 promoter driving an anti-NFATC2 sgRNADepositorInsertNFATC2 sgRNA
UseCRISPR and Synthetic BiologyAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMtnA FFLuc SV40
Plasmid#176299PurposeExpresses firefly luciferase (FFLuc) mRNA from the Drosophila Metallothionein A promoterDepositorInsertFirefly luciferase
Tags3xFLAGExpressionInsectPromoterMtnAAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only