We narrowed to 4,010 results for: SPL;
-
Plasmid#199767PurposeExpresses split-intein fused MSPdH45 for circularization during expression (internal His-Tag)DepositorInsertcMSPdH45
TagsHis6-TagExpressionBacterialMutationinternal His-TagAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-NTEVp(WT)
Plasmid#137831PurposeCytosolic split-TEV protease chain with FKBP Rapamycin sensing domain, N-terminal WT TEV proteaseDepositorInsertFKBP-NTEVp(WT)
Tags3x FLAG and NESExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
FRB-CTEVp(WT)
Plasmid#137832PurposeCytosolic split-TEV protease chain with FRB Rapamycin sensing domain, C-terminal WT TEV proteaseDepositorInsertFRB-CTEVp(WT)
Tags3x FLAG and NESExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFP.R270
Plasmid#138219PurposeExpresses the split mCherry reporter interrupted by the IMPDH-1 intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP.R269
Plasmid#138181PurposeExpresses the split mCherry reporter interrupted by the NrdJ-1 intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP.R268
Plasmid#138180PurposeExpresses the split mCherry reporter interrupted by the gp41-8 intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYSD063
Plasmid#212916PurposeEncodes mRuby2 fluorescent protein as a Type 3b' part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsertmRuby2
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSarQ27G-VMAn-FKBP
Plasmid#70230PurposeExpresses N-terminal portion of alpha sarcin with Q27G mutation along with VMA intein for protein splicingDepositorInsertalpha Sarcin (N-terminal portion)
TagsFK506- and rapamycin-binding protein (FKBP), Link…ExpressionMammalianMutationChanged Gln 27 to GlyPromoterCMVAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG385 bJun-NFAST-NLS-DEVDG-mCherry-NES
Plasmid#130816PurposeExpresses bJun-NFAST-NLS-DEVDG-mCherry-NES in mammalian cellsDepositorInsertbJun-NFAST-NLS-DEVDG-mCherry-NES
ExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
modified pcAT7-Glo1
Plasmid#160996PurposeSplicing reporter backboneDepositorInserthemoglobin subunit beta (HBB Human)
ExpressionMammalianMutationRepeated intron 1 with 40 nucelotide deletionPromoterCAGAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-NGFP-VMAn-FKBP
Plasmid#70225PurposeExpresses N-terminal portion of GFP along with VMA intein for protein splicingDepositorInserteGFP
TagsFK506- and rapamycin-binding protein (FKBP), Link…ExpressionMammalianMutationChanged Glu 125 to Ile, Deleted amino acids 129-2…PromoterCMVAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FRB-VMAc-CGFP
Plasmid#70226PurposeExpresses C-terminal portion of GFP along with VMA intein for protein splicingDepositorInserteGFP
TagsFKBP-rapamycin binding (FRB) domain of the mammal…ExpressionMammalianMutationChanged Ile 129 to Cys, Deleted amino acids 1-128PromoterCMVAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
3XFLAG-NSarQ27G-VMAn-FKBP
Plasmid#70229PurposeExpresses FLAG tagged N-terminal portion of alpha sarcin with Q27G mutation along with VMA intein for protein splicingDepositorInsertalpha Sarcin (N-terminal portion)
Tags3XFLAG, FK506- and rapamycin-binding protein (FKB…ExpressionMammalianMutationChanged Gln 27 to GlyPromoterCMVAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:S10-(MCS)
Plasmid#108177PurposeBinary vectors used for the inducible expression of tripartite split-sfGFP components in plantsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS178
Plasmid#215678PurposeEmpty repair plasmid for ChrII split hygromycinR landing padDepositorInsert5'HA + MCS + loxP + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:(MCS)-S11-DI-GFP1–9
Plasmid#108260PurposeBinary vectors used for the inducible expression of dual intein-coupled tripartite split-sfGFP components in plantsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only